Pink-tailed Worm lizard, Phylogenomics, Illumina Capture, liver
Dataset size is: 0.00 Bit
Data and Resources
-
350820_AHHVV2AFX2_CGGTGACATG_S32... Metadata Only FASTQ
-
350820_AHHVV2AFX2_CGGTGACATG_S32... Metadata Only FASTQ
-
350820_AHHVV2AFX2_CGGTGACATG_S32... Metadata Only FASTQ
-
350820_AHHVV2AFX2_CGGTGACATG_S32... Metadata Only FASTQ
-
350820_AHHVV2AFX2_CGGTGACATG_S32... Metadata Only FASTQ
-
350820_AHHVV2AFX2_CGGTGACATG_S32... Metadata Only FASTQ
-
350820_AHHVV2AFX2_CGGTGACATG_S32... Metadata Only FASTQ
-
350820_AHHVV2AFX2_CGGTGACATG_S32... Metadata Only FASTQ
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
Field | Value |
---|---|
Geospatial Coverage |
Dataset extentMap tiles & Data by OpenStreetMap, under CC BY SA.
|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members |
Access Control Date | 2022-05-04 |
Access Control Mode | date |
Sequence Data Type | Illumina Capture |
access_rights | No restrictions |
ala_specimen_url | https://ozcam.ala.org.au/occurrences/2d50514e-05e6-47a7-aedd-0e03e41201ad |
analysis_software | Bcl2Fastq |
ancillary_notes | NA |
associated_media | NA |
barcode_id | unknown |
base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/exon_capture/brf/BPAOPS-1066/ |
certainty | NA |
class | Reptilia |
collection_date | 1987-11-16 |
collection_method | unknown |
collector | G.G. Swan |
collector_sample_id | NA |
common_name | Pink-tailed Worm lizard |
coord_uncertainty_metres | unknown |
country | Australia |
data_context | Phylogenomics |
data_custodian | Ian Brennan |
data_type | Illumina Capture |
dataset_id | 102.100.100/351767 |
date_of_transfer | 2021-05-04 |
date_of_transfer_to_archive | 2021-05-10 |
decimal_latitude_public | -35.17 |
decimal_longitude_public | 147.88 |
description | Short reads |
dna_treatment | Fragmentation by Covaris |
experimental_design | Perkin Elmer DNA-Seq Rapid 2.0 Libraries with Arbor (Daicel) Biosciences Exon Capture - dual index |
facility | BRF |
facility_project_code | NA |
facility_sample_id | 349810_AHHVV2AFX2_CGGTGACATG |
family | Pygopodidae |
file_type | FASTQ |
flowcell_id | AHHVV2AFX2 |
flowcell_type | Mid output 300 cycles |
folder_name | 20210504_AusARG_BRF_AHHVV2AFX2 |
genotypic_sex | not determined |
genus | Aprasia |
habitat | unknown |
identified_by | Glenn Shea |
insert_size_range | 150 bp PE |
institution_name | Australian Museum Sydney |
latitude | -35.17 |
library_comments | Full library reaction; qubit 13.3 ng/uL |
library_construction_protocol | NEXTFLEX Rapid DNA-Seq Kit 2.0 |
library_id | 102.100.100/350820 |
library_index_id | P7_UDI_0032 |
library_index_id_dual | P5_UID_0032 |
library_index_seq | CGGTGACATG |
library_index_seq_dual | AGATGCCGGT |
library_layout | paired end |
library_location | ANU EBL Freezer |
library_ng_ul | 13.3 |
library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCAC cggtgacatgATCTCGTATGCCGTCTTCTGCTTG |
library_oligo_sequence_dual | AATGATACGGCGACCACCGAGATCTACAC agatgccggtACACTCTTTCCCTACACGACGCTCTTCCGATCT |
library_pcr_cycles | 4 |
library_pcr_reps | 1 |
library_prep_date | 2021-02-20 |
library_prepared_by | Ian Brennan |
library_selection | Hybrid Selection |
library_source | GENOMIC |
library_strategy | Targeted-Capture |
library_type | Exon capture |
lifestage | unknown |
location_text | Tarcutta |
longitude | 147.88 |
material_conc_ng_ul | 160.0 |
material_extracted_by | Ian Brennan |
material_extraction_date | 2020-09-01 |
material_extraction_method | Salt extraction |
material_extraction_type | DNA |
metadata_revision_date | 2023-03-14 |
metadata_revision_filename | AusARG_Metadata_master_QCIF_20230314.xlsx |
method_of_determination | not determined |
n_libraries_pooled | 32 |
order | Squamata |
phenotypic_sex | not determined |
phylum | Chordata |
prior_genetics | unknown |
project_aim | Phylogenomics |
sample_custodian | Jodi Rowley |
sample_id | 102.100.100/349810 |
sample_quality | unknown |
sequencing_facility | Biomolecular Research Facility - ANU |
sequencing_kit_chemistry_version | NextSeq 500 midoutput 300 cycles V2.5 |
sequencing_model | NextSeq 500 |
sequencing_platform | Illumina |
source_population | NA |
species | parapulchella |
species_name | Aprasia parapulchella |
specimen_id | AMS R127439 |
specimen_id_description | Australian Museum Sydney |
state_or_region | New South Wales |
subspecies | NA |
taxon_id | 207572 |
taxonomic_group | lizard | gecko |
ticket | BPAOPS-1066 |
tissue_collection | Herpetology (R) |
tissue_number | AMS R127439 |
tissue_preservation | ethanol |
tissue_type | liver |
type_status | non type |
voucher_or_tissue_number | NR363 |
wild_captive | wild |
work_order | 13018 |