Northern blind snake, Phylogenomics, Illumina Capture, liver
Dataset size is: 0.00 Bit
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Geospatial Coverage |
Dataset extentMap tiles & Data by OpenStreetMap, under CC BY SA.
|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members |
| Access Control Date | 2023-02-21 |
| Access Control Mode | date |
| Sequence Data Type | Illumina Capture |
| access_rights | No restrictions |
| ala_specimen_url | unknown |
| analysis_software | Bcl2Fastq |
| ancillary_notes | NA |
| associated_media | NA |
| barcode_id | unknown |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/exon_capture/brf/BPAOPS-1366/20220218_AusARG_BRF_HWHLKDRXY/ |
| certainty | NA |
| class | Reptilia |
| collection_date | 1993-07-29 |
| collection_method | unknown |
| collector | Paul Horner |
| collector_sample_id | unknown |
| common_name | Northern blind snake |
| coord_uncertainty_metres | unknown |
| country | Australia |
| data_context | Phylogenomics |
| data_custodian | Sarin Tiatragul |
| data_type | Illumina Capture |
| dataset_id | 102.100.100/351808 |
| dataset_url | (132 samples) WAS BPAOPS-1196 |
| date_of_transfer | 2022-02-21 |
| date_of_transfer_to_archive | 2022-02-24 |
| decimal_latitude_public | 11.525 |
| decimal_longitude_public | 136.4166667 |
| description | Short reads |
| dna_treatment | 26 biorupter cycles |
| experimental_design | Capture probes |
| facility | BRF |
| facility_project_code | NA |
| family | Typhlopidae |
| file_type | FASTQ |
| flowcell_id | HWHLKDRXY |
| flowcell_type | Novaseq SP |
| folder_name | 20220218_AusARG_BRF_HWHLKDRXY |
| genotypic_sex | not determined |
| genus | Anilios |
| habitat | unknown |
| identified_by | unknown |
| insert_size_range | 150bp PE |
| institution_name | Australian Biological Tissue Collection, South Australian Museum |
| latitude | 11.53 |
| library_construction_protocol | NEXTFLEX_2.0_RapidDNASeq |
| library_id | 102.100.100/353872 |
| library_index_id | P7_UDI_0106 |
| library_index_id_dual | P5_UDI_0106 |
| library_index_seq | AACACCCAAT |
| library_index_seq_dual | TGAAGACCCT |
| library_layout | paired end |
| library_location | ANU EBL Freezer |
| library_ng_ul | 106.0 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACAACACCCAATATCTCGTATGCCGTCTTCTGCTTG |
| library_oligo_sequence_dual | AATGATACGGCGACCACCGAGATCTACACAGGGTCTTCAACACTCTTTCCCTACACGACGCTCTTCCGATCT |
| library_pcr_cycles | 16 |
| library_pcr_reps | 2 |
| library_prep_date | 2021-07-08 |
| library_prepared_by | Liz Broady |
| library_selection | Hybrid Selection |
| library_source | GENOMIC |
| library_strategy | Targeted-Capture |
| library_type | Exon capture |
| lifestage | adult organism |
| location_generalisation | 1km |
| location_text | Guluwuru Island |
| longitude | 136.42 |
| material_conc_ng_ul | 106.0 |
| material_extracted_by | Sarin Tiatragul |
| material_extraction_date | 2021-08-20 |
| material_extraction_method | Salt precipitation |
| material_extraction_type | DNA |
| metadata_revision_date | 2023-03-14 |
| metadata_revision_filename | AusARG_Metadata_master_QCIF_20230314.xlsx |
| method_of_determination | not determined |
| n_libraries_pooled | 132 |
| order | Squamata |
| phenotypic_sex | not determined |
| phylum | Chordata |
| prior_genetics | 12S KF992981.1 | 16S KF993068.1 | Cyt b JQ910552 | PRLR JQ910438 |
| project_aim | Phylogenomics |
| sample_custodian | Sarin Tiatragul |
| sample_id | 102.100.100/352858 |
| sample_quality | unknown |
| sequencing_facility | Biomolecular Research Facility - ANU |
| sequencing_kit_chemistry_version | 300 cycles |
| sequencing_model | NovaSeq 6000 |
| sequencing_platform | Illumina |
| source_population | unknown |
| species | diversus |
| species_name | Anilios diversus |
| specimen_id | MAGNT R19058 |
| specimen_id_description | Museums and Art Galleries of the Northern Territory |
| state_or_region | Northern Territory |
| subspecies | NA |
| taxon_id | 759983 |
| taxonomic_group | snake |
| ticket | BPAOPS-1366 |
| tissue_collection | Herpetology |
| tissue_number | ABTC29286 |
| tissue_preservation | frozen |
| tissue_type | liver |
| type_status | no |
| voucher_or_tissue_number | MAGNT R19058 |
| wild_captive | wild |
| work_order | 13037 |