NA, Phylogenomics, Illumina Capture, liver

Typhlopidae, Anilios broomi, SMZ 0364, snake, Project Lead: Sarin Tiatragul

Dataset size is: 0.00 Bit

Log in or Register to access resource
 
 

 

Data and Resources

This data is made available openly under a Creative Commons Attribution license. Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Geospatial Coverage

Dataset extent

Map tiles & Data by OpenStreetMap, under CC BY SA.
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members
Access Control Date 2023-02-21
Access Control Mode date
Sequence Data Type Illumina Capture
access_rights No restrictions
ala_specimen_url unknown
analysis_software Bcl2Fastq
ancillary_notes NA
associated_media NA
barcode_id unknown
base_url https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/exon_capture/brf/BPAOPS-1366/20220218_AusARG_BRF_HWHLKDRXY/
certainty NA
class Reptilia
collection_date 2015-12-07
collection_method Found active on surface near base of hill with granite outcrops.
collector Stephen Zozaya
collector_sample_id unknown
common_name NA
coord_uncertainty_metres unknown
country Australia
data_context Phylogenomics
data_custodian Sarin Tiatragul
data_type Illumina Capture
dataset_id 102.100.100/351808
dataset_url (132 samples) WAS BPAOPS-1196
date_of_transfer 2022-02-21
date_of_transfer_to_archive 2022-02-24
decimal_latitude_public -20.313156
decimal_longitude_public 146.8787
description Short reads
dna_treatment 23 biorupter cycles
experimental_design Capture probes
facility BRF
facility_project_code NA
family Typhlopidae
file_type FASTQ
flowcell_id HWHLKDRXY
flowcell_type Novaseq SP
folder_name 20220218_AusARG_BRF_HWHLKDRXY
genotypic_sex not determined
genus Anilios
habitat unknown
identified_by Stephen Zozaya
insert_size_range 150bp PE
institution_name Stephen M Zozaya Collection
latitude -20.313156
library_comments sample re-extracted, same DNA treatment as last
library_construction_protocol NEXTFLEX_2.0_RapidDNASeq
library_id 102.100.100/353959
library_index_id P7_UDI_0193
library_index_id_dual P5_UDI_0193
library_index_seq TGGCAGGGCG
library_index_seq_dual TATAGGGTCT
library_layout paired end
library_location ANU EBL Freezer
library_ng_ul 74.4
library_oligo_sequence GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGGCAGGGCGATCTCGTATGCCGTCTTCTGCTTG
library_oligo_sequence_dual AATGATACGGCGACCACCGAGATCTACACAGACCCTATAACACTCTTTCCCTACACGACGCTCTTCCGATCT
library_pcr_cycles 16
library_pcr_reps 2
library_prep_date 2021-07-08
library_prepared_by Liz Broady
library_selection Hybrid Selection
library_source GENOMIC
library_strategy Targeted-Capture
library_type Exon capture
lifestage adult organism
location_text 24 km S. of Ravenswood
longitude 146.8787
material_conc_ng_ul 74.4
material_extracted_by Sarin Tiatragul
material_extraction_date 2020-06-09
material_extraction_method Salt precipitation
material_extraction_type DNA
metadata_revision_date 2023-03-14
metadata_revision_filename AusARG_Metadata_master_QCIF_20230314.xlsx
method_of_determination not determined
n_libraries_pooled 132
order Squamata
phenotypic_sex not determined
phylum Chordata
prior_genetics unknown
project_aim Phylogenomics
sample_custodian Sarin Tiatragul
sample_id 102.100.100/352945
sample_quality unknown
sequencing_facility Biomolecular Research Facility - ANU
sequencing_kit_chemistry_version 300 cycles
sequencing_model NovaSeq 6000
sequencing_platform Illumina
source_population unknown
species broomi
species_name Anilios broomi
specimen_id SMZ 0364
specimen_id_description Stephen M Zozaya
state_or_region Queensland
subspecies NA
taxon_id 1539840
taxonomic_group snake
ticket BPAOPS-1366
tissue_collection Herpetology
tissue_number SMZ0364
tissue_preservation ethanol
tissue_type liver
type_status no
voucher_or_tissue_number SMZ0364
wild_captive wild
work_order 13037