Roberts' Scaly-foot, Phylogenomics, Illumina Capture, liver
Dataset size is: 0.00 Bit
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members |
| Access Control Date | 2023-07-03 |
| Access Control Mode | date |
| Sequence Data Type | Illumina Capture |
| access_rights | No restrictions |
| ala_specimen_url | https://biocache.ala.org.au/occurrences/bb61ef20-100c-4af2-91d5-dc4a512efa2c |
| analysis_software | Bcl2Fastq |
| ancillary_notes | NA |
| associated_media | NA |
| barcode_id | unknown |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/exon_capture/brf/BPAOPS-1367/20220701_AusARG_BRF_351836_HGJFGDRX2/ |
| certainty | NA |
| class | Reptilia |
| collection_method | unknown |
| collector | unknown |
| common_name | Roberts' Scaly-foot |
| coord_uncertainty_metres | unknown |
| country | Australia |
| data_context | Phylogenomics |
| data_custodian | Ian Brennan |
| data_type | Illumina Capture |
| dataset_id | 102.100.100/351836 |
| dataset_url | WAS BPAOPS-1297 |
| date_of_transfer | 2022-07-03 |
| date_of_transfer_to_archive | 2022-07-19 |
| description | Short reads |
| dna_treatment | 60 Biorupter cycles |
| experimental_design | Capture probes |
| facility | BRF |
| facility_project_code | NA |
| family | Pygopodidae |
| file_type | FASTQ |
| flowcell_id | HGJFGDRX2 |
| flowcell_type | Novaseq SP |
| folder_name | 20220701_AusARG_BRF_351836_HGJFGDRX2 |
| genotypic_sex | not determined |
| genus | Pygopus |
| habitat | unknown |
| identified_by | unknown |
| insert_size_range | 150bp PE |
| institution_name | South Australian Museum |
| library_comments | First post library prep PCR didn't produce enough DNA, so second half of libraries were PCR'd with 12 cycles, split across 2 reactions and combined before cleaning. |
| library_construction_protocol | NEXTFLEX_2.0_RapidDNASeq |
| library_id | 102.100.100/354686 |
| library_index_id | P7_UDI_0744 |
| library_index_id_dual | P5_UDI_0744 |
| library_index_seq | TATTCACCAT |
| library_index_seq_dual | CATATTGCTA |
| library_layout | paired end |
| library_location | ANU EBL Freezer |
| library_ng_ul | 14.0 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACCATATTGCTAATCTCGTATGCCGTCTTCTGCTTG |
| library_oligo_sequence_dual | AATGATACGGCGACCACCGAGATCTACACTATTCACCATACACTCTTTCCCTACACGACGCTCTTCCGATCT |
| library_pcr_cycles | 12 |
| library_pcr_reps | 2 |
| library_prep_date | 2022-05-17 |
| library_prepared_by | Liz Broady |
| library_selection | Hybrid Selection |
| library_source | GENOMIC |
| library_strategy | Targeted-Capture |
| library_type | Exon capture |
| lifestage | unknown |
| location_text | Shiptons Flat |
| material_conc_ng_ul | 228.0 |
| material_extracted_by | Ian G Brennan |
| material_extraction_date | 2021-07-01 |
| material_extraction_method | Salt extraction |
| material_extraction_type | DNA |
| metadata_revision_date | 2023-03-14 |
| metadata_revision_filename | AusARG_Metadata_master_QCIF_20230314.xlsx |
| method_of_determination | not determined |
| n_libraries_pooled | 33 |
| order | Squamata |
| phenotypic_sex | not determined |
| phylum | Chordata |
| prior_genetics | unknown |
| project_aim | Phylogenomics |
| sample_custodian | Stephen Donnellan |
| sample_id | 102.100.100/410838 |
| sample_quality | unknown |
| sequencing_facility | Biomolecular Research Facility - ANU |
| sequencing_kit_chemistry_version | 300 cycles |
| sequencing_model | NovaSeq 6000 |
| sequencing_platform | Illumina |
| source_population | NA |
| species | robertsi |
| specimen_id | SAMA ABTC28230 |
| specimen_id_description | South Australian Museum Australian Biological Tissue Collection |
| state_or_region | Queensland |
| subspecies | NA |
| taxon_id | 2773104 |
| taxonomic_group | reptile |
| ticket | BPAOPS-1367 |
| tissue_collection | South Australian Museum Australian Biological Tissue Collection |
| tissue_number | ABTC28230 |
| tissue_preservation | ethanol |
| tissue_type | liver |
| type_status | unknown |
| voucher_or_tissue_number | ABTC28230 |
| wild_captive | wild |
| work_order | 13047 |