Northern Spotted Velvet Gecko|Oedura coggeri|https://biodiversity.org.au/afd/taxa/89e42118-ba6b-4fe9-8d5a-02bdc19abcd7|Northern Spotted Velvet Gecko|Animalia|Diplodactylidae, Phylogenomics, Illumina Capture, unknown
Dataset size is: 0.00 Bit
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
Field | Value |
---|---|
Geospatial Coverage |
Dataset extentMap tiles & Data by OpenStreetMap, under CC BY SA.
|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members |
Access Control Date | 2023-11-04 |
Access Control Mode | date |
Sequence Data Type | Illumina Capture |
access_rights | No restrictions |
ala_specimen_url | unknown |
analysis_software | Bcl2Fastq |
ancillary_notes | NA |
associated_media | NA |
barcode_id | unknown |
base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/exon_capture/brf/BPAOPS-1369/ |
certainty | NA |
class | Reptilia |
collection_method | unknown |
collector | unknown |
collector_sample_id | unknown |
common_name | Northern Spotted Velvet Gecko|Oedura coggeri|https://biodiversity.org.au/afd/taxa/89e42118-ba6b-4fe9-8d5a-02bdc19abcd7|Northern Spotted Velvet Gecko|Animalia|Diplodactylidae |
coord_uncertainty_metres | unknown |
country | Australia |
data_context | Phylogenomics |
data_custodian | Mitzy Pepper |
data_type | Illumina Capture |
dataset_id | 102.100.100/351850 |
dataset_url | WAS BPAOPS-1336 |
date_of_transfer | 2022-11-04 |
date_of_transfer_to_archive | 2022-11-08 |
decimal_latitude_public | -17.40138 |
decimal_longitude_public | 144.64471 |
description | Short reads |
dna_treatment | 80 biorupter cycles |
experimental_design | Capture probes |
facility | BRF |
facility_project_code | NA |
family | Diplodactylidae |
file_type | FASTQ |
flowcell_id | HLYLYDRX2 |
flowcell_type | Novaseq S1 |
folder_name | 20221104_AusARG_BRF_351850_HLYLYDRX2 |
genotypic_sex | not determined |
genus | Oedura |
habitat | unknown |
identified_by | NA |
insert_size_range | 150bp |
institution_name | James Cook University |
latitude | -17.40138 |
library_comments | NA |
library_construction_protocol | NEXTFLEX_2.0_RapidDNASeq |
library_id | 102.100.100/413905 |
library_index_id | p7_UDI_0925 |
library_index_id_dual | p5_UDI_0925 |
library_index_seq | TCAGAGTAAT |
library_index_seq_dual | GCAGGTTACG |
library_layout | paired end |
library_location | ANU EBL Freezer |
library_ng_ul | 19.5 |
library_oligo_sequence | AATGATACGGCGACCACCGAGATCTACACGCAGGTTACGACACTCTTTCCCTACACGACGCTCTTCCGATCT |
library_oligo_sequence_dual | GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCAGAGTAATATCTCGTATGCCGTCTTCTGCTTG |
library_pcr_cycles | 12 |
library_pcr_reps | 2 |
library_prep_date | 2022-09-06 |
library_prepared_by | Liz Broady/ Leo Tedeschi |
library_selection | Hybrid Selection |
library_source | GENOMIC |
library_strategy | Targeted-Capture |
library_type | Exon capture |
lifestage | not determined |
location_text | Almaden area |
longitude | 144.64471 |
material_conc_ng_ul | 40.5 |
material_extracted_by | Mitzy Pepper |
material_extraction_date | 2022-05-01 |
material_extraction_method | Qiagen Silica Column Extraction |
material_extraction_type | DNA |
metadata_revision_date | 2023-03-14 |
metadata_revision_filename | AusARG_Metadata_master_QCIF_20230314.xlsx |
method_of_determination | not determined |
n_libraries_pooled | 190 |
order | Squamata |
phenotypic_sex | not determined |
phylum | Chordata |
prior_genetics | unknown |
project_aim | Phylogenomics |
sample_custodian | Mitzy Pepper |
sample_id | 102.100.100/411431 |
sample_quality | unknown |
sequencing_facility | Biomolecular Research Facility - ANU |
sequencing_kit_chemistry_version | 300 cycles |
sequencing_model | NovaSeq 6000 |
sequencing_platform | Illumina |
source_population | NA |
species | coggeri |
species_name | Oedura coggeri |
specimen_id | CONX5023 |
specimen_id_description | Conrad Hoskin Tissue Collection |
state_or_region | Queensland |
subspecies | NA |
taxon_id | 1165245 |
taxonomic_group | reptile |
ticket | BPAOPS-1369 |
tissue_collection | James Cook University |
tissue_number | CONX5023 |
tissue_preservation | ethanol |
tissue_type | unknown |
type_status | unknown |
voucher_or_tissue_number | no voucher |
wild_captive | wild |
work_order | 13055 |