Jewelled Gecko|Strophurus elderi|https://biodiversity.org.au/afd/taxa/a7ff9493-22da-4afb-baa2-40fcac043a5a|Jewelled Gecko|Animalia|Diplodactylidae, Phylogenomics, Illumina Capture, unknown

Diplodactylidae, Strophurus elderi, WAM R132527, reptile, Project Lead: Mitzy Pepper

Dataset size is: 0.00 Bit

Log in or Register to access resource
 
 

 

Data and Resources

This data is made available openly under a Creative Commons Attribution license. Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Geospatial Coverage

Dataset extent

Map tiles & Data by OpenStreetMap, under CC BY SA.
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members
Access Control Date 2023-11-04
Access Control Mode date
Sequence Data Type Illumina Capture
access_rights No restrictions
ala_specimen_url 19102f60-a54d-4a7d-8406-0924ac9da59f
analysis_software Bcl2Fastq
ancillary_notes NA
associated_media NA
barcode_id unknown
base_url https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/exon_capture/brf/BPAOPS-1369/
certainty NA
class Reptilia
collection_method unknown
collector unknown
collector_sample_id unknown
common_name Jewelled Gecko|Strophurus elderi|https://biodiversity.org.au/afd/taxa/a7ff9493-22da-4afb-baa2-40fcac043a5a|Jewelled Gecko|Animalia|Diplodactylidae
coord_uncertainty_metres 50000.0
country Australia
data_context Phylogenomics
data_custodian Mitzy Pepper
data_type Illumina Capture
dataset_id 102.100.100/351850
dataset_url WAS BPAOPS-1336
date_of_transfer 2022-11-04
date_of_transfer_to_archive 2022-11-08
decimal_latitude_public -20.672222
decimal_longitude_public 116.756111
description Short reads
dna_treatment 70 biorupter cycles
experimental_design Capture probes
facility BRF
facility_project_code NA
family Diplodactylidae
file_type FASTQ
flowcell_id HLYLYDRX2
flowcell_type Novaseq S1
folder_name 20221104_AusARG_BRF_351850_HLYLYDRX2
genotypic_sex not determined
genus Strophurus
habitat unknown
identified_by APLIN, K.P.
insert_size_range 150bp
institution_name Western Australian Museum
latitude -20.672222
library_comments NA
library_construction_protocol NEXTFLEX_2.0_RapidDNASeq
library_id 102.100.100/413931
library_index_id p7_UDI_0951
library_index_id_dual p5_UDI_0951
library_index_seq TGGGTTCGTA
library_index_seq_dual ACCGGTGCAT
library_layout paired end
library_location ANU EBL Freezer
library_ng_ul 4.4
library_oligo_sequence AATGATACGGCGACCACCGAGATCTACACACCGGTGCATACACTCTTTCCCTACACGACGCTCTTCCGATCT
library_oligo_sequence_dual GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGGGTTCGTAATCTCGTATGCCGTCTTCTGCTTG
library_pcr_cycles 12
library_pcr_reps 2
library_prep_date 2022-09-06
library_prepared_by Liz Broady/ Leo Tedeschi
library_selection Hybrid Selection
library_source GENOMIC
library_strategy Targeted-Capture
library_type Exon capture
lifestage not determined
location_text Burrup peninsula
longitude 116.756111
material_conc_ng_ul 74.8
material_extracted_by Mitzy Pepper
material_extraction_date 2022-05-01
material_extraction_method Qiagen Silica Column Extraction
material_extraction_type DNA
metadata_revision_date 2023-03-14
metadata_revision_filename AusARG_Metadata_master_QCIF_20230314.xlsx
method_of_determination not determined
n_libraries_pooled 190
order Squamata
phenotypic_sex not determined
phylum Chordata
prior_genetics unknown
project_aim Phylogenomics
sample_custodian Mitzy Pepper
sample_id 102.100.100/411457
sample_quality unknown
sequencing_facility Biomolecular Research Facility - ANU
sequencing_kit_chemistry_version 300 cycles
sequencing_model NovaSeq 6000
sequencing_platform Illumina
source_population NA
species elderi
species_name Strophurus elderi
specimen_id WAM R132527
specimen_id_description Western Australian Museum Herpetology Collection
state_or_region Western Australia
subspecies NA
taxon_id 1165251
taxonomic_group reptile
ticket BPAOPS-1369
tissue_collection Western Australian Museum Herpetology Collection
tissue_number R132527
tissue_preservation ethanol
tissue_type unknown
type_status unknown
voucher_or_tissue_number R132527
wild_captive wild
work_order 13055