Plains Death Adder|Acanthophis hawkei|https://biodiversity.org.au/afd/taxa/c280fedf-63f2-4c5d-a4b4-ad6263dcaeba|Plains Death Adder|Animalia|Elapidae, Phylogenomics, Illumina Capture, unknown

Elapidae, Acanthophis hawkei, MAGNT R37905, reptile, Project Lead: Damien Esquerre

Dataset size is: 0.00 Bit

Log in or Register to access resource
 
 

 

Data and Resources

This data is made available openly under a Creative Commons Attribution license. Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Geospatial Coverage

Dataset extent

Map tiles & Data by OpenStreetMap, under CC BY SA.
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members
Access Control Date 2023-11-04
Access Control Mode date
Sequence Data Type Illumina Capture
access_rights No restrictions
ala_specimen_url https://biocache.ala.org.au/occurrences/unknown
analysis_software Bcl2Fastq
ancillary_notes NA
associated_media NA
barcode_id unknown
base_url https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/exon_capture/brf/BPAOPS-1370/20221104_AusARG_BRF_351851_HLYLYDRX2/
certainty NA
class Reptilia
collection_method unknown
collector unknown
collector_sample_id unknown
common_name Plains Death Adder|Acanthophis hawkei|https://biodiversity.org.au/afd/taxa/c280fedf-63f2-4c5d-a4b4-ad6263dcaeba|Plains Death Adder|Animalia|Elapidae
coord_uncertainty_metres unknown
country Australia
data_context Phylogenomics
data_custodian Damien Esquerre
data_type Illumina Capture
dataset_id 102.100.100/351851
dataset_url WAS BPAOPS-1337
date_of_transfer 2022-11-04
date_of_transfer_to_archive 2022-11-08
decimal_latitude_public -12.64944
decimal_longitude_public 131.32993
description Short reads
dna_treatment 9 biorupter cycles
experimental_design Capture probes
facility BRF
facility_project_code NA
family Elapidae
file_type FASTQ
flowcell_id HLYLYDRX2
flowcell_type Novaseq S1
folder_name 20221104_AusARG_BRF_351851_HLYLYDRX2
genotypic_sex not determined
genus Acanthophis
habitat unknown
identified_by unknown
insert_size_range 150bp PE
institution_name Museum and Art Gallery of the Northern Territory
latitude -12.64944
library_comments NA
library_construction_protocol NEXTFLEX_2.0_RapidDNASeq
library_id 102.100.100/413947
library_index_id p7_UDI_0969
library_index_id_dual p5_UDI_0969
library_index_seq AGGGCTCCTA
library_index_seq_dual TCATCACGCT
library_layout paired end
library_location ANU EBL Freezer
library_ng_ul 4.5
library_oligo_sequence GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGGGCTCCTAATCTCGTATGCCGTCTTCTGCTTG
library_oligo_sequence_dual AATGATACGGCGACCACCGAGATCTACACTCATCACGCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
library_pcr_cycles 12
library_pcr_reps 2
library_prep_date 2022-09-13
library_prepared_by Liz Broady/Leo Tedeschi
library_selection Hybrid Selection
library_source GENOMIC
library_strategy Targeted-Capture
library_type Exon capture
lifestage unknown
location_text Fogg Dam Area
longitude 131.32993
material_conc_ng_ul 3.264
material_extracted_by Damien Esquerre
material_extraction_date 2022-07-26
material_extraction_method Qiagen Silica Column Extraction
material_extraction_type DNA
metadata_revision_date 2023-03-14
metadata_revision_filename AusARG_Metadata_master_QCIF_20230314.xlsx
method_of_determination not determined
n_libraries_pooled 192
order Squamata
phenotypic_sex not determined
phylum Chordata
prior_genetics unknown
project_aim Phylogenomics
sample_custodian Scott Keogh
sample_id 102.100.100/411473
sample_quality unknown
sequencing_facility Biomolecular Research Facility - ANU
sequencing_kit_chemistry_version 300 cycles
sequencing_model NovaSeq 6000
sequencing_platform Illumina
source_population NA
species hawkei
species_name Acanthophis hawkei
specimen_id MAGNT R37905
specimen_id_description Museum and Art Gallery of the Northern Territory Reptile Collection
state_or_region Northern Territory
subspecies Acanthophis hawkei
taxon_id 1752122
taxonomic_group reptile
ticket BPAOPS-1370
tissue_collection Museum and Art Gallery of the Northern Territory Reptile Collection
tissue_number R37905
tissue_preservation ethanol
tissue_type unknown
type_status unknown
voucher_or_tissue_number R37905
wild_captive wild
work_order 13055