Eastern Three-lined Skink, Reference Genome, Illumina-HiC, liver
Dataset size is: 0.00 Bit
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
Field | Value |
---|---|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members |
Access Control Date | 2022-06-11 |
Access Control Mode | date |
Sequence Data Type | illumina-hic |
analysis_software | Bcl2Fastq |
base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/genomics-hi-c/BPAOPS-1081/20210513_AusARG_BRF_DD2M2/ |
bioplatforms_dataset_id | 351741 |
bioplatforms_library_id | 350752, 350764, 350769, 350768, 350781, 350821 |
bioplatforms_sample_id | 349751, 349763, 349765, 349764, 349775, 349811 |
class | Reptilia |
common_name | Eastern Three-lined Skink |
data_context | Reference Genome |
data_custodian | Arthur Georges |
data_type | Illumina-HiC |
dataset_id | 102.100.100/351741 |
date_of_transfer | 2021-06-11 |
date_of_transfer_to_archive | 2021-06-11 |
description | HiC-QC |
dna_treatment | FA crosllinking restriction enzymes and sonication |
experimental_design | Arima HiC 2.0 single index |
facility | BRF |
facility_sample_id | 350769_DD2M2_CAGATC |
family | Scincidae |
file_type | FASTQ |
flowcell_id | DD2M2 |
flowcell_type | Miseq Nano |
folder_name | 20210513_AusARG_BRF_DD2M2 |
genus | Bassiana |
insert_size_range | 650.0 |
library_comments | Concentration and size was assesd by Bioanalyzer and Qubit |
library_construction_protocol | Arima HiC 2.0 |
library_id | 350769 |
library_index_id | Index 7 |
library_index_seq | CAGATC |
library_layout | paired end |
library_location | Freezer at BRF |
library_ng_ul | 1.2 |
library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATC(AT)CTCGTATGCCGTCTTCTGCTTG |
library_pcr_cycles | 8 |
library_pcr_reps | 1 |
library_prepared_by | Max Nekrasov |
library_selection | Restriction Digest |
library_source | GENOMIC |
library_strategy | Hi-C |
library_type | HiC-QC |
metadata_revision_date | 2023-03-14 |
metadata_revision_filename | AusARG_Metadata_master_QCIF_20230314.xlsx |
n_libraries_pooled | 6 |
order | Squamata |
phylum | Chordata |
project_aim | Reference genome |
sample_custodian | Arthur Georges |
sample_id | 102.100.100/349765 |
scientific_name | Platyplectrum ornatum/Chelodina expansa/Bassiana duperreyi/Pogona vitticeps/Tiliqua rugosa/(Emydura macquarii?) |
sequencing_facility | BRF |
sequencing_kit_chemistry_version | 300 cycles |
sequencing_model | Illumina MiSeq |
sequencing_platform | ILLUMINA |
species | duperreyi |
subspecies | NA |
taxon_id | 316450 |
ticket | BPAOPS-1081 |
tissue_type | liver |
work_order | 13015 |