AusARG Hi-C 102.100.100/405732 HG5YLDMXY
Dataset size is: 0.00 Bit
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
Field | Value |
---|---|
Resource Permissions | organization_member |
Access Control Date | 2023-07-13 |
Access Control Mode | date |
Sequence Data Type | illumina-hic |
analysis_software | Bcl2Fastq |
base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/genomics-hi-c/BPAOPS-1302/20220711_AusARG_BRF_HG5YLDMXY/ |
data_context | Reference genome (HiC) |
data_custodian | Carolyn Hogg |
data_type | Illumina-HiC |
dataset_id | 102.100.100/358785 |
date_of_transfer | 13/07/2022 |
date_of_transfer_to_archive | 14/07/2022 |
description | Short reads |
dna_treatment | FA crosllinking restriction enzymes and sonication |
experimental_design | Arima HiC 2.0 single index |
facility | BRF |
facility_project_code | BRF |
facility_sample_id | 408043_AusARG_BRF_XXXXX_ATGTCA |
file_type | FASTQ |
flowcell_id | HG5YLDMXY |
flowcell_type | Novaseq S2 |
folder_name | 20220711_AusARG_BRF_HG5YLDMXY |
genus | Mixophyes |
insert_size_range | 150bp PE |
library_comments | Concentration and size was assesd by Bioanalyzer and Qubit |
library_construction_protocol | Arima HiC 2.0 |
library_id | 408043 |
library_index_id | Index_15 |
library_index_seq | ATGTCA |
library_layout | paired end |
library_location | Freezer at BRF |
library_ng_ul | 1.6 |
library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCA(AT)CTCGTATGCCGTCTTCTGCTTG |
library_pcr_cycles | 6 |
library_pcr_reps | 1 |
library_prep_date | 2022-06-30 |
library_prepared_by | Max Nekrasov |
library_selection | Restriction Digest |
library_source | GENOMIC |
library_strategy | Hi-C |
library_type | Illumina-HiC |
n_libraries_pooled | 6 |
sample_id | 102.100.100/405732 |
sequencing_facility | BRF |
sequencing_kit_chemistry_version | NovaSeq v1.5 |
sequencing_model | Illumina NovaSeq 6000 |
sequencing_platform | ILLUMINA |
species | balbus |
specimen_id | SBF_USYD |
ticket | BPAOPS-1302 |
tissue_number | SBF_USYD_kidney |
work_order | 13045 |