AusARG Hi-C 102.100.100/405660 HG5YLDMXY
Dataset size is: 0.00 Bit
Data and Resources
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:archive_ingestion_date:365:pp-prj002 |
| Access Control Date | 2023-07-13 |
| Access Control Mode | date |
| Sequence Data Type | illumina-hic |
| analysis_software | Bcl2Fastq |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/genomics-hi-c/BPAOPS-1302/20220711_AusARG_BRF_HG5YLDMXY/ |
| data_context | Reference genome (HiC) |
| data_custodian | Carolyn Hogg |
| data_type | Illumina-HiC |
| dataset_id | 102.100.100/358787 |
| date_of_transfer | 13/07/2022 |
| date_of_transfer_to_archive | 14/07/2022 |
| description | Short reads |
| dna_treatment | FA crosllinking restriction enzymes and sonication |
| experimental_design | Arima HiC 2.0 single index |
| facility | BRF |
| facility_project_code | BRF |
| facility_sample_id | 408045_AusARG_BRF_XXXXX_GTGAAA |
| file_type | FASTQ |
| flowcell_id | HG5YLDMXY |
| flowcell_type | Novaseq S2 |
| folder_name | 20220711_AusARG_BRF_HG5YLDMXY |
| genus | Clitoria |
| insert_size_range | 150bp PE |
| library_comments | Concentration and size was assesd by Bioanalyzer and Qubit |
| library_construction_protocol | Arima HiC 2.0 |
| library_id | 408045 |
| library_index_id | Index_19 |
| library_index_seq | GTGAAA |
| library_layout | paired end |
| library_location | Freezer at BRF |
| library_ng_ul | 1.6 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAA(AT)CTCGTATGCCGTCTTCTGCTTG |
| library_pcr_cycles | 6 |
| library_pcr_reps | 1 |
| library_prep_date | 2022-06-30 |
| library_prepared_by | Max Nekrasov |
| library_selection | Restriction Digest |
| library_source | GENOMIC |
| library_strategy | Hi-C |
| library_type | Illumina-HiC |
| n_libraries_pooled | 6 |
| sample_id | 102.100.100/405660 |
| sequencing_facility | BRF |
| sequencing_kit_chemistry_version | NovaSeq v1.5 |
| sequencing_model | Illumina NovaSeq 6000 |
| sequencing_platform | ILLUMINA |
| species | ternatea |
| specimen_id | UQ_CT_SEQ001.3 |
| ticket | BPAOPS-1302 |
| tissue_number | UQ_CT_SEQ001.3_shoots |
| work_order | 13045 |