Reference Genome, Illumina-HiC
Dataset size is: 0.00 Bit
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
Field | Value |
---|---|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members |
Access Control Date | 2024-08-09 |
Access Control Mode | date |
Sequence Data Type | illumina-hic |
analysis_software | Bcl2Fastq |
base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/genomics-hi-c/BPAOPS-1458/20230810_AusARG_BRF_351896_HKJ33DRX3/ |
bioplatforms_dataset_id | 351897 |
bioplatforms_library_id | 456721 |
bioplatforms_sample_id | 458238 |
data_context | Reference Genome |
data_custodian | Renee Catullo |
data_type | Illumina-HiC |
dataset_id | 102.100.100/351896 |
date_of_transfer | 2023-08-10 |
date_of_transfer_to_archive | 2023-08-14 |
description | HiC |
dna_treatment | FA crosllinking restriction enzymes and sonication |
experimental_design | Arima HiC 2.0 single index |
facility | BRF |
facility_project_code | NA |
facility_sample_id | 456720_AusARG_BRF_HKJ33DRX3_GACTTGAC |
file_type | fastq.gz |
flowcell_id | HKJ33DRX3 |
flowcell_type | NovaSeq 6000 SP |
folder_name | 20230810_AusARG_BRF_351897_HKJ33DRX3 |
genus | Platyplectrum |
insert_size_range | ~1000bp |
library_comments | Concentration and size was assesd by Bioanalyzer and Qubit |
library_construction_protocol | Arima HiC 2.0 |
library_id | 456720 |
library_index_id | Index_13 |
library_index_seq | GACTTGAC |
library_layout | paired-end |
library_location | Freezer at BRF |
library_ng_ul | 1.45 |
library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACGACTTGAC(AT)CTCGTATGCCGTCTTCTGCTTG |
library_pcr_cycles | 6 |
library_pcr_reps | 1 |
library_prep_date | 2023-07-17 |
library_prepared_by | Max Nekrasov |
library_selection | Restriction Digest |
library_source | GENOMIC |
library_strategy | Hi-C |
library_type | Illumina-HiC |
n_libraries_pooled | 2 |
project_aim | Reference genome |
sample_id | 102.100.100/458237 |
scientific_name | Lechriodus fletcheri |
sequencing_facility | BRF |
sequencing_kit_chemistry_version | NovaSeq v1.5 |
sequencing_model | Illumina NovaSeq 6000 |
sequencing_platform | ILLUMINA |
species | ornatum |
specimen_id | SCL005 |
ticket | BPAOPS-1458 |
tissue_number | SC033 |
work_order | 13066 |