Reference Genome, Illumina-HiC
Dataset size is: 0.00 Bit
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members |
| Access Control Date | 2024-08-09 |
| Access Control Mode | date |
| Sequence Data Type | illumina-hic |
| analysis_software | Bcl2Fastq |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/genomics-hi-c/BPAOPS-1458/20230810_AusARG_BRF_351897_HKJ33DRX3/ |
| bioplatforms_dataset_id | 351897 |
| bioplatforms_library_id | 456721 |
| bioplatforms_sample_id | 458238 |
| data_context | Reference Genome |
| data_custodian | Renee Catullo |
| data_type | Illumina-HiC |
| dataset_id | 102.100.100/351897 |
| date_of_transfer | 2023-08-10 |
| date_of_transfer_to_archive | 2023-08-14 |
| description | HiC |
| dna_treatment | FA crosllinking restriction enzymes and sonication |
| experimental_design | Arima HiC 2.0 single index |
| facility | BRF |
| facility_project_code | NA |
| facility_sample_id | 456721_AusARG_BRF_HKJ33DRX3_CTACAATG |
| file_type | fastq.gz |
| flowcell_id | HKJ33DRX3 |
| flowcell_type | NovaSeq 6000 SP |
| folder_name | 20230810_AusARG_BRF_351897_HKJ33DRX3 |
| genus | Lechriodus |
| insert_size_range | ~1000bp |
| library_comments | Concentration and size was assesd by Bioanalyzer and Qubit |
| library_construction_protocol | Arima HiC 2.0 |
| library_id | 456721 |
| library_index_id | Index_14 |
| library_index_seq | CTACAATG |
| library_layout | paired-end |
| library_location | Freezer at BRF |
| library_ng_ul | 1.45 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTACAATG(AT)CTCGTATGCCGTCTTCTGCTTG |
| library_pcr_cycles | 6 |
| library_pcr_reps | 1 |
| library_prep_date | 2023-07-17 |
| library_prepared_by | Max Nekrasov |
| library_selection | Restriction Digest |
| library_source | GENOMIC |
| library_strategy | Hi-C |
| library_type | Illumina-HiC |
| n_libraries_pooled | 2 |
| project_aim | Reference genome |
| sample_id | 102.100.100/458238 |
| scientific_name | Lechriodus fletcheri |
| sequencing_facility | BRF |
| sequencing_kit_chemistry_version | NovaSeq v1.5 |
| sequencing_model | Illumina NovaSeq 6000 |
| sequencing_platform | ILLUMINA |
| species | fletcheri |
| specimen_id | SCL015 |
| ticket | BPAOPS-1458 |
| tissue_number | SC154 |
| work_order | 13066 |