southern gastric-brooding frog, Reference genome, Illumina-shortread, skin
Dataset size is: 0.00 Bit
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
Field | Value |
---|---|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members |
Access Control Date | 2023-04-04 |
Access Control Mode | date |
Sequence Data Type | Illumina-shortread |
access_rights | No restrictions |
ala_specimen_url | unknown |
analysis_software | Real Time Analysis (RTA |
analysis_software_version | v3.4.4 |
ancillary_notes | NA |
associated_media | NA |
barcode_id | unknown |
base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/illumina-fastq/BPAOPS-1215/20220404_AusARG_AGRF_HJLC5DSX3/ |
bioplatforms_dataset_id | 102.100.100/351830 |
bioplatforms_library_id | 102.100.100/354325 |
bioplatforms_sample_id | 102.100.100/353087 |
certainty | NA |
class | Amphibia |
collection_method | hand capture |
collector | Michael Tyler |
collector_sample_id | NA |
common_name | southern gastric-brooding frog |
coord_uncertainty_metres | unknown |
country | Australia |
data_context | Reference genome |
data_custodian | Steve Donnellan |
data_type | Illumina-shortread |
dataset_id | 102.100.100/351830 |
date_of_transfer | 2022-04-04 |
date_of_transfer_to_archive | 2022-04-04 |
description | Short reads |
dna_treatment | not fragmented |
experimental_design | shotgun seq dual index |
facility | AGRF |
facility_project_code | CAGRF22039832 |
facility_sample_id | 354325.0 |
family | Myobatrachidae |
file_type | fastq |
flowcell_id | HJLC5DSX3 |
flowcell_type | S4-300 |
folder_name | 20220404_AusARG_AGRF_HJLC5DSX3 |
genotypic_sex | not determined |
genus | Rheobatrachus |
habitat | unknown |
insert_size_range | 178-610 |
institution_name | South Australian Museum |
library_comments | shotgun seq |
library_construction_protocol | Myer_Kircher 2010 |
library_id | 102.100.100/354325 |
library_index_id | iP7-139-ACTCACTG |
library_index_id_dual | iP5-18-ACTACGGT |
library_index_seq | ACTCACTG |
library_index_seq_dual | ACCGTAGT |
library_layout | paired end |
library_location | Adelaide Uni |
library_ng_ul | 1.4 |
library_oligo_sequence | CAAGCAGAAGACGGCATACGAGATCAGTGAGTGTGACTGGAGTTCAGACGTGT |
library_oligo_sequence_dual | AATGATACGGCGACCACCGAGATCTACACACTACGGTACACTCTTTCCCTACACGACGCTCTT |
library_pcr_cycles | 16 |
library_pcr_reps | 0 |
library_prep_date | 2022-10-28 |
library_prepared_by | Tessa Bradford |
library_selection | RANDOM |
library_source | GENOMIC |
library_strategy | OTHER |
library_type | Illumina-shortread |
lifestage | skin |
location_text | No locality data |
material_conc_ng_ul | 14.0 |
material_extracted_by | Tessa Bradford |
material_extraction_date | 2021-09-16 |
material_extraction_method | Gentra PureGene |
material_extraction_type | DNA |
metadata_revision_date | 2023-03-14 |
metadata_revision_filename | AusARG_Metadata_master_QCIF_20230314.xlsx |
method_of_determination | not determined |
n_libraries_pooled | 5 |
order | Anura |
phenotypic_sex | not determined |
phylum | Chordata |
prior_genetics | unknown |
project_aim | Reference genome |
sample_custodian | Steve Donnellan |
sample_id | 102.100.100/353087 |
sample_quality | degraded |
scientific_name | Rheobatrachus vitellinus |
sequencing_facility | AGRF |
sequencing_kit_chemistry_version | NovaSeq Control Software (NCS) v1.7.5 |
sequencing_model | Illumina NovaSeq 6000 |
sequencing_platform | ILLUMINA |
source_population | NA |
species | vitellinus |
specimen_id | ABTC80607 |
specimen_id_description | South Australian Museum |
state_or_region | Queensland |
subspecies | NA |
taxon_id | 326984 |
taxonomic_group | frog |
ticket | BPAOPS-1215 |
tissue_collection | Australian Biological Tissue Collection |
tissue_number | ABTC80607 |
tissue_preservation | ethanol |
tissue_type | skin |
type_status | no |
voucher_or_tissue_number | ABTC80607 |
wild_captive | wild |
work_order | 13043 |