Reference genome, Illumina-shortread, liver
Dataset size is: 0.00 Bit
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members |
| Access Control Date | 2023-04-04 |
| Access Control Mode | date |
| Sequence Data Type | Illumina-shortread |
| access_rights | No restrictions |
| ala_specimen_url | unknown |
| analysis_software | Real Time Analysis (RTA |
| analysis_software_version | v3.4.4 |
| ancillary_notes | R115171 |
| associated_media | NA |
| barcode_id | unknown |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/illumina-fastq/BPAOPS-1215/20220404_AusARG_AGRF_HJLC5DSX3/ |
| bioplatforms_dataset_id | 102.100.100/351831 |
| bioplatforms_library_id | 102.100.100/354326 |
| bioplatforms_sample_id | 102.100.100/353088 |
| certainty | NA |
| class | Amphibia |
| collection_method | unknown |
| collector | unknown |
| collector_sample_id | NA |
| coord_uncertainty_metres | unknown |
| country | Australia |
| data_context | Reference genome |
| data_custodian | Steve Donnellan |
| data_type | Illumina-shortread |
| dataset_id | 102.100.100/351831 |
| date_of_transfer | 2022-04-04 |
| date_of_transfer_to_archive | 2022-04-04 |
| decimal_latitude_public | -26.303889 |
| decimal_longitude_public | 128.796667 |
| description | Short reads |
| dna_treatment | not fragmented |
| experimental_design | shotgun seq dual index |
| facility | AGRF |
| facility_project_code | CAGRF22039832 |
| facility_sample_id | 354326.0 |
| family | Myobatrachidae |
| file_type | fastq |
| flowcell_id | HJLC5DSX3 |
| flowcell_type | S4-300 |
| folder_name | 20220404_AusARG_AGRF_HJLC5DSX3 |
| genotypic_sex | not determined |
| genus | Pseudophryne |
| habitat | unknown |
| insert_size_range | 178-610 |
| institution_name | South Australian Museum |
| latitude | -26.303889 |
| library_comments | shotgun seq |
| library_construction_protocol | Myer_Kircher 2010 |
| library_id | 102.100.100/354326 |
| library_index_id | iP7-134-AATGGACG |
| library_index_id_dual | iP5-23-TAGAACGC |
| library_index_seq | AATGGACG |
| library_index_seq_dual | GCGTTCTA |
| library_layout | paired end |
| library_location | Adelaide Uni |
| library_ng_ul | 1.4 |
| library_oligo_sequence | CAAGCAGAAGACGGCATACGAGATCGTCCATTGTGACTGGAGTTCAGACGTGT |
| library_oligo_sequence_dual | AATGATACGGCGACCACCGAGATCTACACTAGAACGCACACTCTTTCCCTACACGACGCTCTT |
| library_pcr_cycles | 16 |
| library_pcr_reps | 0 |
| library_prep_date | 2022-10-28 |
| library_prepared_by | Tessa Bradford |
| library_selection | RANDOM |
| library_source | GENOMIC |
| library_strategy | OTHER |
| library_type | Illumina-shortread |
| lifestage | unknown |
| location_text | 5K SW Mt West, WA |
| longitude | 128.796667 |
| material_conc_ng_ul | 4.8 |
| material_extracted_by | Tessa Bradford |
| material_extraction_date | 2021-10-26 |
| material_extraction_method | MagMax core kit |
| material_extraction_type | DNA |
| metadata_revision_date | 2023-03-14 |
| metadata_revision_filename | AusARG_Metadata_master_QCIF_20230314.xlsx |
| method_of_determination | not determined |
| n_libraries_pooled | 5 |
| order | Anura |
| phenotypic_sex | not determined |
| phylum | Chordata |
| prior_genetics | unknown |
| project_aim | Reference genome |
| sample_custodian | Steve Donnellan |
| sample_id | 102.100.100/353088 |
| sample_quality | degraded |
| scientific_name | Pseudophryne occidentalis |
| sequencing_facility | AGRF |
| sequencing_kit_chemistry_version | NovaSeq Control Software (NCS) v1.7.5 |
| sequencing_model | Illumina NovaSeq 6000 |
| sequencing_platform | ILLUMINA |
| source_population | NA |
| species | occidentalis |
| specimen_id | ABTC81111 |
| specimen_id_description | South Australian Museum |
| state_or_region | Western Australia |
| subspecies | NA |
| taxon_id | 1338023 |
| taxonomic_group | frog |
| ticket | BPAOPS-1215 |
| tissue_collection | Australian Biological Tissue Collection |
| tissue_number | ABTC81111 |
| tissue_preservation | ethanol |
| tissue_type | liver |
| type_status | no |
| voucher_or_tissue_number | ABTC81111 |
| wild_captive | wild |
| work_order | 13043 |