Metallic Snake-Eyed Skink, Conservation genomics, Illumina-shortread, tail tip

Scincidae, Cryptoblepharus metallicus, NTMR37449, reptile

Dataset size is: 0.00 Bit

Log in or Register to access resource
 
 

 

Data and Resources

This data is made available openly under a Creative Commons Attribution license. Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members
Access Control Date 2023-11-15
Access Control Mode date
Sequence Data Type Illumina-shortread
access_rights no restrictions
ala_specimen_url unknown
analysis_software NovaSeq Control Software (NCS) v1.7.5 and Real Time Analysis (RTA) v3.4.4, DRAGEN BCL Convert 07.021.609.3.9.3
analysis_software_version NovaSeq Control Software (NCS) v1.7.5 and Real Time Analysis (RTA) v3.4.4, DRAGEN BCL Convert 07.021.609.3.9.3
ancillary_notes NA
associated_media NA
barcode_id unknown
base_url https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/illumina-fastq/BPAOPS-1338/20221115_AusARG_AGRF_HGCMNDSX5/
bioplatforms_dataset_id 102.100.100/351839
bioplatforms_library_id 102.100.100/412573
bioplatforms_sample_id 102.100.100/410964
certainty NA
class Reptilia
collection_date 2013-05-14
collection_method hand caught
collector Craig Moritz
common_name Metallic Snake-Eyed Skink
coord_uncertainty_metres unknown
country Australia
data_context Conservation genomics
data_custodian Sofia Hayden
data_type Illumina-shortread
dataset_id 102.100.100/351839
date_of_transfer 2022-11-15
date_of_transfer_to_archive 2022-11-16
decimal_latitude_public -16.02894
decimal_longitude_public 130.80029
description Short reads
dna_treatment 5 Biorupter cycles
facility AGRF
facility_project_code CAGRF220911985
family Scincidae
file_type .fastq.gz
flowcell_id HGCMNDSX5
flowcell_type S4
folder_name 20221115_AusARG_AGRF_HGCMNDSX5
genotypic_sex not determined
genus Cryptoblepharus
habitat unknown
i5_index_reverse_complement AGTTCCCATT
identified_by Craig Moritz
insert_size_range 150bp PE
institution_name Northern Territory Museum
latitude -16.02894
library_comments PCR were split across 2 reactions and combined before cleaning
library_construction_protocol NEXTFLEX_2.0_RapidDNASeq
library_id 102.100.100/412573
library_index_id P7_UDI_0774
library_index_id_dual P5_UDI_0774
library_index_seq AAAGAACATG
library_index_seq_dual AATGGGAACT
library_layout Paired end
library_location EBL Freezer
library_ng_ul 13.9654776141
library_oligo_sequence AATGATACGGCGACCACCGAGATCTACACAAAGAACATGACACTCTTTCCCTACACGACGCTCTTCCGATCT
library_oligo_sequence_dual GATCGGAAGAGCACACGTCTGAACTCCAGTCACAATGGGAACTATCTCGTATGCCGTCTTCTGCTTG
library_pcr_cycles 12
library_pcr_reps 2
library_prep_date 2022-08-31
library_prepared_by Sofia Hayden
library_selection size fractionation
library_source GENOMIC
library_strategy WGS
library_type WGS
lifestage unknown
location_text Jasper Gorge Skinking
longitude 130.80029
material_conc_ng_ul 5.92
material_extracted_by Mozes Blom
material_extraction_method salt precipitation method
material_extraction_type DNA
metadata_revision_date 2023-03-14
metadata_revision_filename AusARG_Metadata_master_QCIF_20230314.xlsx
method_of_determination visual determination
n_libraries_pooled 80
order Squamata
phenotypic_sex female
phylum Chordata
prior_genetics unknown
project_aim Conservation Genomics
sample_custodian Craig Moritz
sample_id 102.100.100/410964
sample_quality unknown
scientific_name Cryptoblepharus metallicus
sequencing_facility AGRF
sequencing_kit_chemistry_version NovaSeq v1.5
sequencing_model NovaSeq 6000 SP, 300 cycle
sequencing_platform ILLUMINA
source_population Australia, Northern Territory
species metallicus
specimen_id NTMR37449
specimen_id_description Northern Territory Museum
state_or_region Northern Territory
subspecies NA
taxon_id 2509234
taxonomic_group reptile
ticket BPAOPS-1338
tissue_collection Craig Moritz's tissue collection
tissue_number CCM0611
tissue_preservation RNAlater
tissue_type tail tip
type_status unknown
voucher_or_tissue_number NTMR37449
wild_captive wild
work_order 13050