Metallic Snake-Eyed Skink, Conservation genomics, Illumina-shortread, tail tip
Dataset size is: 0.00 Bit
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
Field | Value |
---|---|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members |
Access Control Date | 2023-11-15 |
Access Control Mode | date |
Sequence Data Type | Illumina-shortread |
access_rights | no restrictions |
ala_specimen_url | unknown |
analysis_software | NovaSeq Control Software (NCS) v1.7.5 and Real Time Analysis (RTA) v3.4.4, DRAGEN BCL Convert 07.021.609.3.9.3 |
analysis_software_version | NovaSeq Control Software (NCS) v1.7.5 and Real Time Analysis (RTA) v3.4.4, DRAGEN BCL Convert 07.021.609.3.9.3 |
ancillary_notes | NA |
associated_media | NA |
barcode_id | unknown |
base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/illumina-fastq/BPAOPS-1338/20221115_AusARG_AGRF_HGCMNDSX5/ |
bioplatforms_dataset_id | 102.100.100/351839 |
bioplatforms_library_id | 102.100.100/412638 |
bioplatforms_sample_id | 102.100.100/411029 |
certainty | NA |
class | Reptilia |
collection_date | 2017-05-13 |
collection_method | hand caught |
collector | Craig Moritz |
common_name | Metallic Snake-Eyed Skink |
coord_uncertainty_metres | 20.0 |
country | Australia |
data_context | Conservation genomics |
data_custodian | Sofia Hayden |
data_type | Illumina-shortread |
dataset_id | 102.100.100/351839 |
date_of_transfer | 2022-11-15 |
date_of_transfer_to_archive | 2022-11-16 |
decimal_latitude_public | -16.04288 |
decimal_longitude_public | 130.69678 |
description | Short reads |
dna_treatment | 6 Biorupter cycles |
facility | AGRF |
facility_project_code | CAGRF220911985 |
family | Scincidae |
file_type | .fastq.gz |
flowcell_id | HGCMNDSX5 |
flowcell_type | S4 |
folder_name | 20221115_AusARG_AGRF_HGCMNDSX5 |
genotypic_sex | not determined |
genus | Cryptoblepharus |
habitat | unknown |
i5_index_reverse_complement | TCTGAGTGAT |
identified_by | Craig Moritz |
insert_size_range | 150bp PE |
institution_name | Moritz Lab ANU |
latitude | -16.04288 |
library_comments | PCR were split across 2 reactions and combined before cleaning |
library_construction_protocol | NEXTFLEX_2.0_RapidDNASeq |
library_id | 102.100.100/412638 |
library_index_id | P7_UDI_0839 |
library_index_id_dual | P5_UDI_0839 |
library_index_seq | GCCCTCAATA |
library_index_seq_dual | ATCACTCAGA |
library_layout | Paired end |
library_location | EBL Freezer |
library_ng_ul | 0.0 |
library_oligo_sequence | AATGATACGGCGACCACCGAGATCTACACGCCCTCAATAACACTCTTTCCCTACACGACGCTCTTCCGATCT |
library_oligo_sequence_dual | GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACTCAGAATCTCGTATGCCGTCTTCTGCTTG |
library_pcr_cycles | 12 |
library_pcr_reps | 2 |
library_prep_date | 2022-08-31 |
library_prepared_by | Sofia Hayden |
library_selection | size fractionation |
library_source | GENOMIC |
library_strategy | WGS |
library_type | WGS |
lifestage | unknown |
location_text | Gregory National Park: EMPG07 |
longitude | 130.69678 |
material_conc_ng_ul | 11.0 |
material_extracted_by | Leonardo Tedeschi |
material_extraction_date | 2022-08-22 |
material_extraction_method | salt precipitation method |
material_extraction_type | DNA |
metadata_revision_date | 2023-03-14 |
metadata_revision_filename | AusARG_Metadata_master_QCIF_20230314.xlsx |
method_of_determination | visual determination |
n_libraries_pooled | 80 |
order | Squamata |
phenotypic_sex | male |
phylum | Chordata |
prior_genetics | unknown |
project_aim | Conservation Genomics |
sample_custodian | Craig Moritz |
sample_id | 102.100.100/411029 |
sample_quality | unknown |
scientific_name | Cryptoblepharus metallicus |
sequencing_facility | AGRF |
sequencing_kit_chemistry_version | NovaSeq v1.5 |
sequencing_model | NovaSeq 6000 SP, 300 cycle |
sequencing_platform | ILLUMINA |
source_population | Australia, Northern Territory |
species | metallicus |
specimen_id | no voucher |
specimen_id_description | Moritz Lab ANU |
state_or_region | Northern Territory |
subspecies | NA |
taxon_id | 2509234 |
taxonomic_group | reptile |
ticket | BPAOPS-1338 |
tissue_collection | Craig Moritz's tissue collection |
tissue_number | CCM7067 |
tissue_preservation | RNAlater |
tissue_type | tail tip |
type_status | unknown |
voucher_or_tissue_number | CCM7067 |
wild_captive | wild |
work_order | 13050 |