Reference genome, Illumina-HiC
Dataset size is: 0.00 Bit
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
Field | Value |
---|---|
Resource Permissions | organization_member |
Access Control Date | 2025-02-09 |
Access Control Mode | date |
Sequence Data Type | illumina-hic |
analysis_software | DRAGEN BCLConvert |
base_url | https://downloads-qcif.bioplatforms.com/bpa/avian_staging/genomics-hi-c/BPAOPS-1747/ |
bioplatforms_dataset_id | 102.100.100/613515 |
bioplatforms_library_id | 102.100.100/611523 |
bioplatforms_project | Australian Avian Genomics Initiative (AVIAN) |
bioplatforms_sample_id | 102.100.100/609523 |
ccg_jira_ticket | BPAOPS-1747 |
data_context | Reference genome |
data_type | Illumina-HiC |
date_of_transfer | 2024-02-10 |
date_of_transfer_to_archive | 2025-02-14 |
dna_treatment | FA crosslinking |
experimental_design | 4.1.23 |
facility_project_code | NA |
facility_sample_id | 611523_AVIAN_BRF_22KYTHLT4_CTTCGGTT |
flowcell_id | 22KYTHLT4 |
flowcell_type | NovaSeq X 25B |
folder_name | 20250210_AVIAN_BRF_613515_22KYTHLT4 |
insert_size_range | ~600bp |
library_construction_protocol | HiC Arima 2.0 |
library_id | 611523 |
library_index_id | NEB_Set1_H11 |
library_index_seq | CTTCGGTT |
library_layout | Paired end |
library_location | BRF Freezer |
library_ng_ul | 1.3 |
library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTCGGTT(AT)CTCGTATGCCGTCTTCTGCTTG |
library_pcr_cycles | 7 |
library_pcr_reps | 1 |
library_prepared_by | Max Nekrasov |
library_selection | Restriction digest |
library_source | GENOMIC |
library_strategy | HiC |
library_type | Illumina-HiC |
n_libraries_pooled | 1 |
project_collaborators | Rhiannon Schembri |
project_lead | Simon Griffith |
sample_id | ZBF_B1035.02 |
scientific_name | Taeniopygia castanotis |
sequencing_facility | BRF |
sequencing_model | NovaSeq X |
sequencing_platform | Illumina |
specimen_id | ZBF_B1035 |
ticket | BPAOPS-1747 |
work_order | 26003 |