Reference genome, Illumina-HiC

None None, ZBF_B1035, Simon Griffith

Dataset size is: 0.00 Bit

Log in or Register to access resource
 
 

 

Data and Resources

This data is made available openly under a Creative Commons Attribution license. Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Resource Permissions organization_member
Access Control Date 2025-02-09
Access Control Mode date
Sequence Data Type illumina-hic
analysis_software DRAGEN BCLConvert
base_url https://downloads-qcif.bioplatforms.com/bpa/avian_staging/genomics-hi-c/BPAOPS-1747/
bioplatforms_dataset_id 102.100.100/613515
bioplatforms_library_id 102.100.100/611523
bioplatforms_project Australian Avian Genomics Initiative (AVIAN)
bioplatforms_sample_id 102.100.100/609523
ccg_jira_ticket BPAOPS-1747
data_context Reference genome
data_type Illumina-HiC
date_of_transfer 2024-02-10
date_of_transfer_to_archive 2025-02-14
dna_treatment FA crosslinking
experimental_design 4.1.23
facility_project_code NA
facility_sample_id 611523_AVIAN_BRF_22KYTHLT4_CTTCGGTT
flowcell_id 22KYTHLT4
flowcell_type NovaSeq X 25B
folder_name 20250210_AVIAN_BRF_613515_22KYTHLT4
insert_size_range ~600bp
library_construction_protocol HiC Arima 2.0
library_id 611523
library_index_id NEB_Set1_H11
library_index_seq CTTCGGTT
library_layout Paired end
library_location BRF Freezer
library_ng_ul 1.3
library_oligo_sequence GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTCGGTT(AT)CTCGTATGCCGTCTTCTGCTTG
library_pcr_cycles 7
library_pcr_reps 1
library_prepared_by Max Nekrasov
library_selection Restriction digest
library_source GENOMIC
library_strategy HiC
library_type Illumina-HiC
n_libraries_pooled 1
project_collaborators Rhiannon Schembri
project_lead Simon Griffith
sample_id ZBF_B1035.02
scientific_name Taeniopygia castanotis
sequencing_facility BRF
sequencing_model NovaSeq X
sequencing_platform Illumina
specimen_id ZBF_B1035
ticket BPAOPS-1747
work_order 26003