Scarlet-chested parrot, Reference genome, ONT-promethion, Heart
Dataset size is: 0.00 Bit
This dataset is currently under a short embargo period until August 11, 2026 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
-
AVIAN_BRF_PBE93634_ONTPromethION... Metadata Only HTML
-
AVIAN_BRF_PBE93634_ONTPromethION... Metadata Only TAR
Optional
-
612142_AVIAN_BRF_PBE93634_ONTPro... Metadata Only TAR
-
612142_AVIAN_BRF_PBE93634_ONTPro... Metadata Only TAR
-
AVIAN_BRF_PBE93634_metadata.xlsx Metadata Only XLSX
-
AVIAN_BRF_PBE93634_ONTPromethION... Metadata Only
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:aus-avian-consortium-members |
| Access Control Date | 2026-08-11 |
| Access Control Mode | date |
| Sequence Data Type | ont-promethion |
| analysis_software | MinKNOW 25.03.7 |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/avian_staging/ont-promethion/BPAOPS-1855/20250722_AVIAN_BRF_PBE93634/ |
| bioplatforms_dataset_id | 102.100.100/613551 |
| bioplatforms_library_id | 102.100.100/612142 |
| bioplatforms_project | Australian Avian Genomics Initiative |
| bioplatforms_sample_id | 102.100.100/610133 |
| ccg_jira_ticket | BPAOPS-1855 |
| cell_postion | 2E |
| class | Aves |
| collection_date | 1988-12-08 |
| common_name | Scarlet-chested parrot |
| country | Australia |
| data_context | Reference genome |
| data_type | ONT-promethion |
| date_of_transfer | 2025-08-11 |
| date_of_transfer_to_archive | 2025-08-12 |
| experimental_design | ONT long reads |
| facility_project_code | ONT_gDNA175_973 |
| facility_sample_id | 973-4 |
| family | Psittaculidae |
| fast5_compression | pod5 vbz |
| flowcell_id | PBE93634 |
| flowcell_type | FLO-PRO114M |
| folder_name | 20250722_AVIAN_BRF_PBE93634 |
| genus | Neophema |
| insert_size_range | 6.5 Kbp |
| library_comments | Run interrupted by power shutdown. Re-started and generated another data paackage |
| library_construction_protocol | Native barcoded ligation libraries with NBD114 |
| library_id | 612142 |
| library_index_id | barcode19 |
| library_index_seq | GTTCCTCGTGCAGTGTCAAGAGAT |
| library_layout | NA |
| library_location | BRF labs |
| library_ng_ul | 18.8 |
| library_oligo_sequence | 5' - AAGGTTAA - barcode - CAGCACCT - 3' |
| library_prep_date | 2025-07-23 |
| library_prepared_by | Ziyan Zhang |
| library_selection | random |
| library_source | genomic |
| library_strategy | WGS |
| library_type | ONT-PromethION |
| lifestage | Adult |
| location_text | Captive, aviary |
| material_conc_ng_ul | 279 (56ul) |
| material_extracted_by | Meg Emery, Luke Silver |
| material_extraction_date | 2025-05-19 |
| material_extraction_method | PacBio Nanobind Circulomics |
| material_extraction_type | DNA |
| metadata_revision_date | 2025-07-22 |
| metadata_revision_filename | 20250722_AVIAN_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx |
| model_base_caller | Super-accurate basecalling v4.3.0, 400 bps |
| movie_length | 2d18h |
| n_libraries_pooled | 2.0 |
| order | Psittaciformes |
| phenotypic_sex | Male |
| phylum | Chordata |
| project_collaborators | Luke Silver |
| project_lead | Carolyn Hogg |
| run_number | 1 |
| sample_collection_type | Wildlife Biobank |
| sample_custodian | Museums Victoria |
| sample_id | Z38602_scarlet_chested_heart |
| sample_id_description | Museums Victoria Voucher number, Neophema species, tissue type |
| sample_type | Tissue sample |
| scientific_name | Neophema splendida |
| scientific_name_authorship | Gould, 1841 |
| sequencing_facility | BRF |
| sequencing_kit_chemistry_version | SQK-NBD114.24 |
| sequencing_model | ONT PromethION |
| sequencing_platform | Oxford Nanopore |
| species | splendida |
| specimen_custodian | Museums Victoria |
| specimen_id | Z38602 |
| specimen_id_description | Museums Victoria Neophema holdings |
| state_or_region | Captive |
| taxon_id | 492514 |
| taxonomic_group | Bird |
| ticket | BPAOPS-1855 |
| tissue | Heart |
| tissue_preservation | Frozen |
| tissue_preservation_temperature | -196.0 |
| wild_captive | Captive |
| work_order | 26008.0 |