Elegant parrot, Reference genome, ONT-promethion, Heart
Dataset size is: 0.00 Bit
This dataset is currently under a short embargo period until August 11, 2026 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
-
AVIAN_BRF_PBE83711_metadata.xlsx Metadata Only XLSX
-
AVIAN_BRF_PBE83711_ONTPromethION... Metadata Only
-
612152_AVIAN_BRF_PBE83711_ONTPro... Metadata Only TAR
-
AVIAN_BRF_PBE83711_ONTPromethION... Metadata Only
-
AVIAN_BRF_PBE83711_ONTPromethION... Metadata Only HTML
-
AVIAN_BRF_PBE83711_ONTPromethION... Metadata Only TAR
Optional
-
612152_AVIAN_BRF_PBE83711_ONTPro... Metadata Only TAR
Additional Info Show Blank Fields
Field | Value |
---|---|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:aus-avian-consortium-members |
Access Control Date | 2026-08-11 |
Access Control Mode | date |
Sequence Data Type | ont-promethion |
analysis_software | MinKNOW 25.03.7 |
base_url | https://downloads-qcif.bioplatforms.com/bpa/avian_staging/ont-promethion/BPAOPS-1853/20250722_AVIAN_BRF_PBE83711/ |
bioplatforms_dataset_id | 102.100.100/613549 |
bioplatforms_library_id | 102.100.100/612152 |
bioplatforms_project | Australian Avian Genomics Initiative |
bioplatforms_sample_id | 102.100.100/610130 |
ccg_jira_ticket | BPAOPS-1853 |
cell_postion | 2B |
class | Aves |
collection_date | 1996-10-05 |
collector | Les Christidis |
common_name | Elegant parrot |
country | Australia |
data_context | Reference genome |
data_type | ONT-promethion |
date_of_transfer | 2025-08-11 |
dna_treatment | DNA shearing with th Hamilton Microlab |
experimental_design | ONT long reads |
facility_project_code | ONT_gDNA175_973 |
facility_sample_id | 973-1 |
family | Psittaculidae |
fast5_compression | pod5 vbz |
flowcell_id | PBE83711 |
flowcell_type | FLO-PRO114M |
folder_name | 20250722_AVIAN_BRF_PBE83711 |
genus | Neophema |
indigenous_location | Noongar |
insert_size_range | 15 Kbp |
library_construction_protocol | Native barcoded ligation libraries with NBD114 |
library_id | 612152 |
library_index_id | barcode21 |
library_index_seq | GAGCCTCTCATTGTCCGTTCTCTA |
library_layout | NA |
library_location | BRF labs |
library_ng_ul | 24.1 |
library_oligo_sequence | 5' - AAGGTTAA - barcode - CAGCACCT - 3' |
library_prep_date | 2025-07-23 |
library_prepared_by | Ziyan Zhang |
library_selection | random |
library_source | genomic |
library_strategy | WGS |
library_type | ONT-PromethION |
lifestage | Adult |
location_info_restricted | yes |
location_text | Borden, 10km south |
material_conc_ng_ul | 38.24 (114ul) |
material_extracted_by | Meg Emery, Luke Silver |
material_extraction_date | 2025-05-19 |
material_extraction_method | PacBio Nanobind Circulomics |
material_extraction_type | DNA |
metadata_revision_date | 2025-07-22 |
metadata_revision_filename | 20250722_AVIAN_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx |
model_base_caller | Super-accurate basecalling v4.3.0, 400 bps |
movie_length | 2d18h |
n_libraries_pooled | 4.0 |
order | Psittaciformes |
phenotypic_sex | Male |
phylum | Chordata |
project_collaborators | Luke Silver |
project_lead | Carolyn Hogg |
run_number | 1 |
sample_collection_type | Wildlife Biobank |
sample_custodian | Museums Victoria |
sample_id | Z3873_elegant_heart |
sample_id_description | Museums Victoria Voucher number, Neophema species, tissue type |
sample_type | Tissue sample |
scientific_name | Neophema elegans |
scientific_name_authorship | Gould, 1837 |
sequencing_facility | BRF |
sequencing_kit_chemistry_version | SQK-NBD114.24 |
sequencing_model | ONT PromethION |
sequencing_platform | Oxford Nanopore |
species | elegans |
specimen_custodian | Museums Victoria |
specimen_id | Z3873 |
specimen_id_description | Museums Victoria Neophema holdings |
state_or_region | Western Australia |
taxon_id | 85098 |
taxonomic_group | Bird |
ticket | BPAOPS-1853 |
tissue | Heart |
tissue_preservation | Frozen |
tissue_preservation_temperature | -196.0 |
wild_captive | Wild |
work_order | 26008.0 |