Turquoise parrot, Reference genome, ONT-promethion, Heart
Dataset size is: 0.00 Bit
This dataset is currently under a short embargo period until August 11, 2026 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
-
612154_AVIAN_BRF_PBE83711_ONTPro... Metadata Only TAR
-
612154_AVIAN_BRF_PBE83711_ONTPro... Metadata Only TAR
-
AVIAN_BRF_PBE83711_ONTPromethION... Metadata Only HTML
-
AVIAN_BRF_PBE83711_ONTPromethION... Metadata Only
-
AVIAN_BRF_PBE83711_ONTPromethION... Metadata Only
-
AVIAN_BRF_PBE83711_ONTPromethION... Metadata Only TAR
Optional
-
AVIAN_BRF_PBE83711_metadata.xlsx Metadata Only XLSX
Additional Info Show Blank Fields
Field | Value |
---|---|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:aus-avian-consortium-members |
Access Control Date | 2026-08-11 |
Access Control Mode | date |
Sequence Data Type | ont-promethion |
analysis_software | MinKNOW 25.03.7 |
base_url | https://downloads-qcif.bioplatforms.com/bpa/avian_staging/ont-promethion/BPAOPS-1853/20250722_AVIAN_BRF_PBE83711/ |
bioplatforms_dataset_id | 102.100.100/613549 |
bioplatforms_library_id | 102.100.100/612154 |
bioplatforms_project | Australian Avian Genomics Initiative |
bioplatforms_sample_id | 102.100.100/610132 |
ccg_jira_ticket | BPAOPS-1853 |
cell_postion | 2B |
class | Aves |
collection_date | 1988-11-08 |
common_name | Turquoise parrot |
country | Australia |
data_context | Reference genome |
data_type | ONT-promethion |
date_of_transfer | 2025-08-11 |
dna_treatment | DNA shearing with th Hamilton Microlab |
experimental_design | ONT long reads |
facility_project_code | ONT_gDNA175_973 |
facility_sample_id | 973-3 |
family | Psittaculidae |
fast5_compression | pod5 vbz |
flowcell_id | PBE83711 |
flowcell_type | FLO-PRO114M |
folder_name | 20250722_AVIAN_BRF_PBE83711 |
genus | Neophema |
indigenous_location | Wiradjuri |
insert_size_range | 15 Kbp |
library_construction_protocol | Native barcoded ligation libraries with NBD114 |
library_id | 612154 |
library_index_id | barcode23 |
library_index_seq | CTTACTACCCAGTGAACCTCCTCG |
library_layout | NA |
library_location | BRF labs |
library_ng_ul | 24.1 |
library_oligo_sequence | 5' - AAGGTTAA - barcode - CAGCACCT - 3' |
library_prep_date | 2025-07-23 |
library_prepared_by | Ziyan Zhang |
library_selection | random |
library_source | genomic |
library_strategy | WGS |
library_type | ONT-PromethION |
lifestage | Adult |
location_info_restricted | yes |
location_text | Weddin Mt |
material_conc_ng_ul | 80.01 (114ul) |
material_extracted_by | Meg Emery, Luke Silver |
material_extraction_date | 2025-05-19 |
material_extraction_method | PacBio Nanobind Circulomics |
material_extraction_type | DNA |
metadata_revision_date | 2025-07-22 |
metadata_revision_filename | 20250722_AVIAN_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx |
model_base_caller | Super-accurate basecalling v4.3.0, 400 bps |
movie_length | 2d18h |
n_libraries_pooled | 4.0 |
order | Psittaciformes |
phenotypic_sex | Female |
phylum | Chordata |
project_collaborators | Luke Silver |
project_lead | Carolyn Hogg |
run_number | 1 |
sample_collection_type | Wildlife Biobank |
sample_custodian | Museums Victoria |
sample_id | Z41396_turquoise_heart |
sample_id_description | Museums Victoria Voucher number, Neophema species, tissue type |
sample_type | Tissue sample |
scientific_name | Neophema pulchella |
scientific_name_authorship | Shaw, 1792 |
sequencing_facility | BRF |
sequencing_kit_chemistry_version | SQK-NBD114.24 |
sequencing_model | ONT PromethION |
sequencing_platform | Oxford Nanopore |
species | pulchella |
specimen_custodian | Museums Victoria |
specimen_id | Z41396 |
specimen_id_description | Museums Victoria Neophema holdings |
state_or_region | New South Wales |
taxon_id | 678582 |
taxonomic_group | Bird |
ticket | BPAOPS-1853 |
tissue | Heart |
tissue_preservation | Frozen |
tissue_preservation_temperature | -196.0 |
wild_captive | Wild |
work_order | 26008.0 |