Blue-winged parrot, Reference genome, ONT-promethion, Heart
Dataset size is: 0.00 Bit
This dataset is currently under a short embargo period until August 11, 2026 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
-
AVIAN_BRF_PBE83711_Run2_ONTProme... Metadata Only TAR
Optional
-
AVIAN_BRF_PBE83711_Run2_ONTProme... Metadata Only HTML
-
AVIAN_BRF_PBE83711_Run2_metadata.xlsx Metadata Only XLSX
-
612155_AVIAN_BRF_PBE83711_Run2_O... Metadata Only TAR
-
AVIAN_BRF_PBE83711_Run2_ONTProme... Metadata Only
-
612155_AVIAN_BRF_PBE83711_Run2_O... Metadata Only TAR
-
AVIAN_BRF_PBE83711_Run2_ONTProme... Metadata Only
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:aus-avian-consortium-members |
| Access Control Date | 2026-08-11 |
| Access Control Mode | date |
| Sequence Data Type | ont-promethion |
| analysis_software | MinKNOW 25.03.7 |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/avian_staging/ont-promethion/BPAOPS-1854/20250728_AVIAN_BRF_PBE83711/ |
| bioplatforms_dataset_id | 102.100.100/613550 |
| bioplatforms_library_id | 102.100.100/612155 |
| bioplatforms_project | Australian Avian Genomics Initiative |
| bioplatforms_sample_id | 102.100.100/610134 |
| ccg_jira_ticket | BPAOPS-1854 |
| cell_postion | 2B |
| class | Aves |
| collection_date | 2025-05-15 |
| collector | Chris Wilson |
| common_name | Blue-winged parrot |
| country | Australia |
| data_context | Reference genome |
| data_type | ONT-promethion |
| date_of_transfer | 2025-08-11 |
| dna_treatment | DNA shearing with th Hamilton Microlab |
| experimental_design | ONT long reads |
| facility_project_code | ONT_gDNA175_973 |
| facility_sample_id | 973-5 |
| family | Psittaculidae |
| fast5_compression | pod5 vbz |
| flowcell_id | PBE83711 |
| flowcell_type | FLO-PRO114M |
| folder_name | 20250728_AVIAN_BRF_PBE83711 |
| genus | Neophema |
| indigenous_location | Wadawurrung |
| insert_size_range | 15 Kbp |
| library_construction_protocol | Native barcoded ligation libraries with NBD114 |
| library_id | 612155 |
| library_index_id | barcode24 |
| library_index_seq | GCATAGTTCTGCATGATGGGTTAG |
| library_layout | NA |
| library_location | BRF labs |
| library_ng_ul | 24.1 |
| library_oligo_sequence | 5' - AAGGTTAA - barcode - CAGCACCT - 3' |
| library_prep_date | 2025-07-23 |
| library_prepared_by | Ziyan Zhang |
| library_selection | random |
| library_source | genomic |
| library_strategy | WGS |
| library_type | ONT-PromethION |
| lifestage | Adult |
| location_info_restricted | yes |
| location_text | Connewarre |
| material_conc_ng_ul | 114.5 (57ul) |
| material_extracted_by | Meg Emery, Luke Silver |
| material_extraction_date | 2025-06-26 |
| material_extraction_method | PacBio Nanobind Circulomics |
| material_extraction_type | DNA |
| metadata_revision_date | 2025-07-22 |
| metadata_revision_filename | 20250722_AVIAN_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx |
| model_base_caller | Super-accurate basecalling v4.3.0, 400 bps |
| movie_length | 2d18h |
| n_libraries_pooled | 4.0 |
| order | Psittaciformes |
| phenotypic_sex | Female |
| phylum | Chordata |
| project_collaborators | Luke Silver |
| project_lead | Carolyn Hogg |
| run_number | 2 |
| sample_collection_type | Wildlife Biobank |
| sample_custodian | CSIRO |
| sample_id | B62247_blue_wing_heart |
| sample_id_description | CSIRO Reg Number, Neophema Species, tissue type |
| sample_type | Tissue sample |
| scientific_name | Neophema chrysostoma |
| scientific_name_authorship | Kuhl, 1820 |
| sequencing_facility | BRF |
| sequencing_kit_chemistry_version | SQK-NBD114.24 |
| sequencing_model | ONT PromethION |
| sequencing_platform | Oxford Nanopore |
| species | chrysostoma |
| specimen_custodian | CSIRO |
| specimen_id | B62247 |
| specimen_id_description | National Bird Collections CSIRO |
| state_or_region | Victoria |
| taxon_id | 357722 |
| taxonomic_group | Bird |
| ticket | BPAOPS-1854 |
| tissue | Heart |
| tissue_preservation | RNAlater frozen |
| tissue_preservation_temperature | -20 then -80 |
| wild_captive | Wild |
| work_order | 26008.0 |