Red handfish, Reference genome, ONT-promethion, Whole body
Dataset size is: 0.00 Bit
This dataset is currently under a short embargo period until August 11, 2026 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
-
616587_FISH_BRF_PBE93634_ONTProm... Metadata Only TAR
-
FISH_BRF_PBE93634_ONTPromethION_pod5.tar Metadata Only TAR
Optional
-
FISH_BRF_PBE93634_ONTPromethION_... Metadata Only HTML
-
FISH_BRF_PBE93634_metadata.xlsx Metadata Only XLSX
-
616587_FISH_BRF_PBE93634_ONTProm... Metadata Only TAR
-
FISH_BRF_PBE93634_ONTPromethION_... Metadata Only
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member |
| Access Control Date | 2026-08-11 |
| Access Control Mode | date |
| Sequence Data Type | ont-promethion |
| analysis_software | MinKNOW 25.03.7 |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/fish_staging/ont-promethion/BPAOPS-1857/20250722_FISH_BRF_PBE93634/ |
| bioplatforms_dataset_id | 102.100.100/618587 |
| bioplatforms_library_id | 102.100.100/616587 |
| bioplatforms_project | Australian Fish Genomics Initiative |
| bioplatforms_project_ncbi_umbrellabioproject_id | PRJNA1098053 |
| bioplatforms_sample_id | 102.100.100/614587 |
| birth_date | 2024-12-05 |
| ccg_jira_ticket | BPAOPS-1857 |
| cell_postion | 2E |
| class | Actinopterygii |
| collection_date | 2025-04-04 |
| collection_method | Hand |
| collection_permit | NA - opportunistic collection of naturally deceased individual |
| collector | IMAS |
| collector_sample_id | 24-3:75 (75) |
| common_name | Red handfish |
| country | Australia |
| data_context | Reference genome |
| data_type | ONT-promethion |
| date_of_transfer | 2025-08-11 |
| date_of_transfer_to_archive | 2025-08-12 |
| death_date | 2025-04-04 |
| dna_treatment | RNAseA treatment |
| env_broad_scale | marine biome [ENVO_00000447] |
| env_local_scale | ocean biome [ENVO_01000048] |
| env_medium | seawater [ENVO_01001964] |
| experimental_design | ONT long reads |
| facility_project_code | ONT_gDNA175_973 |
| facility_sample_id | 973-6 |
| family | Brachionichthyidae |
| fast5_compression | pod5 vbz |
| flowcell_id | PBE93634 |
| flowcell_type | FLO-PRO114M |
| folder_name | 20250722_FISH_BRF_PBE93634 |
| genotypic_sex | not determined |
| genus | Thymichthys |
| habitat | Aquaria |
| health_state | Dead |
| identified_by | IMAS |
| insert_size_range | 6.5 Kbp |
| library_comments | Run interrupted by power shutdown. Re-started and generated another data paackage |
| library_construction_protocol | Native barcoded ligation libraries with NBD114 |
| library_id | 616587 |
| library_index_id | barcode20 |
| library_index_seq | TTGCGTCCTGTTACGAGAACTCAT |
| library_layout | NA |
| library_location | BRF labs |
| library_ng_ul | 18.8 |
| library_oligo_sequence | 5' - AAGGTTAA - barcode - CAGCACCT - 3' |
| library_prep_date | 2025-07-23 |
| library_prepared_by | Ziyan Zhang |
| library_selection | random |
| library_source | genomic |
| library_strategy | WGS |
| library_type | ONT-PromethION |
| lifestage | Juvenile |
| location_info_restricted | Yes |
| location_text | 15-21 Nubeena Cres, Taroona TAS 7053 |
| material_conc_ng_ul | 32.535 |
| material_extracted_by | Elspeth McLennan |
| material_extraction_date | 2025-05-26 |
| material_extraction_method | PacBio DNA Nanobind |
| material_extraction_type | DNA |
| metadata_revision_date | 2025-07-24 |
| metadata_revision_filename | 20250724_FISH_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx |
| method_sex_determination | not determined |
| model_base_caller | Super-accurate basecalling v4.3.0, 400 bps |
| movie_length | 2d18h |
| n_libraries_pooled | 2.0 |
| order | Lophiiformes |
| phenotypic_sex | not determined |
| phylum | Chordata |
| project_collaborators | Elspeth McLennan |
| project_lead | Carolyn Hogg |
| run_number | 1 |
| sample_collection_type | Dissection |
| sample_custodian | Carolyn Hogg |
| sample_id | 24-3:75 (75) |
| sample_id_description | IMAS ID |
| sample_quality | Medium |
| sample_type | Head and body |
| scientific_name | Thymichthys politus |
| scientific_name_authorship | Richardson |
| sequencing_facility | BRF |
| sequencing_kit_chemistry_version | SQK-NBD114.24 |
| sequencing_model | ONT PromethION |
| sequencing_platform | Oxford Nanopore |
| source_population | Captive population |
| species | politus |
| specimen_custodian | Carolyn Hogg |
| specimen_id | 24-3:75 (75) |
| specimen_id_description | IMAS ID |
| state_or_region | Tasmania |
| taxonomic_group | Fish |
| temperature | 16.0 |
| ticket | BPAOPS-1857 |
| tissue | Whole body |
| tissue_preservation | Flash frozen |
| tissue_preservation_temperature | -80.0 |
| wild_captive | Captive |
| work_order | 27002.0 |