unclassified Cryoendolithus, reference genome, ont-promethion, NA
Dataset size is: 722.95 GiB
This dataset is currently under a short embargo period until October 22, 2025 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
-
465909_FUN_BRF_PAW74909_ONTProme... Metadata Only TAR
-
FUN_BRF_PAW74909_ONTPromethION_r... Metadata Only HTML
-
FUN_BRF_PAW74909_ONTPromethION_b... Metadata Only
-
465909_FUN_BRF_PAW74909_ONTProme... Metadata Only TAR
-
FUN_BRF_PAW74909_ONTPromethION_s... Metadata Only
-
FUN_BRF_PAW74909_ONTPromethION_pod5.tar Metadata Only TAR
Optional
-
FUN_BRF_PAW74909_metadata.xlsx Metadata Only XLSX
Additional Info Show Blank Fields
Field | Value |
---|---|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:fungi-consortium-members |
Access Control Date | 2025-10-22 |
Access Control Mode | date |
Sequence Data Type | ont-promethion |
altitude | 25.25 |
analysis_software | MinKNOW 24.06.14 |
ancillary_notes | Funding: AAS-4406 |
associated_media | NA |
base_url | https://downloads-qcif.bioplatforms.com/bpa/fungi_staging/ont-promethion/BPAOPS-1708/20241017_FUN_BRF_PAW74909/ |
bioplatforms_dataset_id | 102.100.100/467798 |
bioplatforms_library_id | 102.100.100/465909 |
bioplatforms_project | Australian Functional Fungi Initiative |
bioplatforms_sample_id | 102.100.100/463909 |
ccg_jira_ticket | BPAOPs-1708 |
cell_postion | 2E |
class | Dothideomycetes |
collection_date | 2019-02-16 |
collection_method | Dry-sieving |
collection_permit | ATEP 18-19-4406 |
collector | Belinda Ferrari, Catherine King, Eden Zhang, Daniel Wilkins, Mark Raymond |
collector_sample_id | AAD 174394 |
common_name | unclassified Cryoendolithus |
country | Antarctica |
data_context | reference genome |
data_type | ONT-promethion |
date_of_transfer | 2024-10-22 |
date_of_transfer_to_archive | 2024-10-24 |
decimal_latitude_public | -66.36774 |
decimal_longitude_public | 110.58534 |
depth | 0.03-0.1 |
dna_treatment | Blue pippin 10Kb size selection |
env_broad_scale | polar biome [ENVO_01000339] |
env_local_scale | polar desert biome [ENVO_01000186], cold desert [ENVO_01000382] |
env_medium | soil [ENVO_00001998] |
experimental_design | ONT long reads |
facility_project_code | NA |
facility_sample_id | ONT_gDNA132_790_2 |
family | Cladosporiaceae |
fast5_compression | pod5 bvz |
flow_cell_id | PAW74909 |
flowcell_id | PAW74909 |
flowcell_type | FLO-PRO114M |
folder_name | 20241017_FUN_BRF_PAW74909 |
genus | Cryoendolithus |
habitat | polar desert biome |
health_state | NA |
host_common_name | NA |
host_family | NA |
host_organ | NA |
host_scientific_name | NA |
host_status | NA |
host_symptom | NA |
identified_by | Priyanka R. Majumdar | Nicole Benaud | Xabier Vázquez-Campos | Belinda Ferrari | Brett Summerell |
indigenous_location | NA |
insert_size_range | 24.1 Kbp |
isolate | KMR193 |
library_construction_protocol | Native barcoded ligation libraries with NBD114 |
library_id | 465909 |
library_index_id | barcode23 |
library_index_seq | CTTACTACCCAGTGAACCTCCTCG |
library_layout | ONT-PromethION |
library_location | BRF labs |
library_ng_ul | 4.35 |
library_oligo_sequence | 5' - AAGGTTAA - barcode - CAGCACCT - 3' |
library_prep_date | 2024-10-17 |
library_prepared_by | Ziyan Zhang |
library_selection | random |
library_source | genomic |
library_strategy | WGS |
library_type | ont-promethion |
life_stage | NA |
location_info_restricted | no |
location_text | Robinson Ridge |
material_conc_ng_ul | Unknown |
material_extracted_by | Priyanka R. Majumdar |
material_extraction_method | CTAB-based |
material_extraction_type | DNA |
metadata_revision_date | 2024-11-12 |
metadata_revision_filename | FUN_MASTER_sample_metadata_FORDP_20241111_NOLATLON.xlsx |
model_base_caller | Super-accurate basecalling v4.3.0, 400 bps |
movie_length | 72h |
n_libraries_pooled | 3.0 |
order | Cladosporiales |
phylum | Ascomycota |
project_lead | Belinda Ferrari |
sample_collection_type | Living collection |
sample_custodian | Belinda Ferrari (UNSW) |
sample_id | KMR193_DNA_LR |
sample_id_description | specimen_id+extracted_material(+condition+replicate) |
sample_quality | Excellent |
sample_type | Whole organism |
scientific_name | unclassified Cryoendolithus |
scientific_name_authorship | M. Piątek, M. Stryjak-Bogacka & P. Czachura |
scientific_name_note | new sp. - undescribed. No placeholder for undescribed Cryoendolithus available |
sequencing_facility | BRF |
sequencing_kit_chemistry_version | SQK-NBD114.24 |
sequencing_model | ONT PromethION |
sequencing_platform | Oxford Nanopore |
source_population | NA |
specimen_custodian | Belinda Ferrari (UNSW) |
specimen_id | KMR193 |
specimen_id_description | Ferrari lab fungal Internal identifier |
state_or_region | Eastern ANorthern Territoryarctica |
taxon_id | 3112694.0 |
taxonomic_group | Fungi |
temperature | Unknown |
ticket | BPAOPS-1708 |
tissue | NA |
tissue_preservation | NA |
tissue_preservation_temperature | NA |
type_status | NA |
wild_captive | Other (culture) |
work_order | 21017.0 |