Black Fungus, black bread mould, reference genome, ONT-PromethION, Grain
Dataset size is: 15.13 GiB
This dataset is currently under a short embargo period until February 26, 2026 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
-
FUN_BRF_PBA04981_ONTPromethION_pod5.tar Metadata Only TAR
Optional
-
FUN_BRF_PBA04981_metadata.xlsx Metadata Only XLSX
-
466446_FUN_BRF_PBA04981_ONTProme... Metadata Only TAR
-
466446_FUN_BRF_PBA04981_ONTProme... Metadata Only TAR
-
FUN_BRF_PBA04981_ONTPromethION_b... Metadata Only
-
FUN_BRF_PBA04981_ONTPromethION_r... Metadata Only HTML
-
FUN_BRF_PBA04981_ONTPromethION_s... Metadata Only
Additional Info Show Blank Fields
Field | Value |
---|---|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:fungi-consortium-members |
Access Control Date | 2026-02-26 |
Access Control Mode | date |
Sequence Data Type | ont-promethion |
altitude | NA |
analysis_software | MinKNOW 24.11.11 |
ancillary_notes | NA |
associated_media | None |
base_url | https://downloads-qcif.bioplatforms.com/bpa/fungi_staging/ont-promethion/BPAOPS-1762/20250218_FUN_BRF_PBA04981/ |
bioplatforms_dataset_id | 102.100.100/467801 |
bioplatforms_library_id | 102.100.100/466446 |
bioplatforms_project | Australian Functional Fungi Initiative |
bioplatforms_sample_id | 102.100.100/464446 |
ccg_jira_ticket | BPAOPS-1762 |
cell_postion | 3E |
class | Mucoromycetes |
collection_date | 2021-06-01 |
collection_method | Culturing on Potato Dextrose Broth |
collection_permit | Institutional Biosafety Committee (IBC) |
collector | Caterina Selva |
collector_sample_id | ENV_001 |
common_name | Black Fungus, black bread mould |
country | Australia |
data_context | reference genome |
data_type | ONT-promethion |
date_of_transfer | 2025-02-26 |
date_of_transfer_to_archive | 2025-02-28 |
decimal_latitude_public | -34.9689609125 |
decimal_longitude_public | 138.6387299784 |
depth | NA |
dna_treatment | Blue pippin 15 Kb size selection |
env_broad_scale | NA |
env_local_scale | NA |
env_medium | NA |
experimental_design | ONT long reads |
facility_project_code | NA |
facility_sample_id | 864-1 |
family | Mucoraceae |
fast5_compression | pod5 bvz |
flow_cell_id | PBA04981 |
flowcell_id | PBA04981 |
flowcell_type | FLO-PRO114M |
folder_name | /20250218_FUN_BRF_PBA04981 |
genus | Rhizopus |
habitat | Maize grains |
health_state | Healthy |
host_common_name | Maize |
host_family | Poaceae |
host_organ | Grain |
host_scientific_name | Zea mays |
host_status | Cultivated |
host_symptom | NA |
identified_by | Caterina Selva, Flinders University |
indigenous_location | Kaurna |
insert_size_range | 30 Kbp |
isolate | Environmental isolate |
library_construction_protocol | Native barcoded ligation libraries with NBD114 |
library_id | 466446 |
library_index_id | barcode16 |
library_index_seq | CGTCAACTGACAGTGGTTCGTACT |
library_layout | NA |
library_location | BRF labs |
library_ng_ul | 8.06 |
library_oligo_sequence | 5' - AAGGTTAA - barcode - CAGCACCT - 3' |
library_prep_date | 2025-02-19 |
library_prepared_by | Carolina Correa-Ospina |
library_selection | random |
library_source | genomic |
library_strategy | WGS |
library_type | ONT-PromethION |
life_stage | NA |
location_info_restricted | no |
location_text | Found growing on maize grains at Waite Campus, Urrbrae |
material_conc_ng_ul | 100.0 |
material_extracted_by | Caterina Selva |
material_extraction_date | 2024-07-11 |
material_extraction_method | Phenol chloroform |
material_extraction_type | gDNA |
metadata_revision_date | 2024-11-12 |
metadata_revision_filename | FUN_MASTER_sample_metadata_FORDP_20241111_NOLATLON.xlsx |
model_base_caller | Super-accurate basecalling v4.3.0, 400 bps |
movie_length | 76h |
n_libraries_pooled | 3.0 |
order | Mucorales |
phylum | Mucoromycota |
project_lead | Caterina Selva |
sample_collection_type | living organism |
sample_custodian | Caterina Selva |
sample_id | ENV_001_Mycelia_DNA |
sample_id_description | Personal, created by Caterina Selva |
sample_quality | Absorbance ratios A260/280 and A260/230 within AGRF reccommendations |
sample_type | tissue sample |
scientific_name | Rhizopus arrhizus |
scientific_name_authorship | Fischer, 1892 |
scientific_name_note | Many taxonomic synonyms. For example, R. oryzae and R. delemar |
sequencing_facility | BRF |
sequencing_kit_chemistry_version | SQK-NBD114.24 |
sequencing_model | ONT PromethION |
sequencing_platform | Oxford Nanopore |
source_population | NA |
species | arrhizus |
specimen_custodian | Caterina Selva, Flinders University |
specimen_id | ENV_001 |
specimen_id_description | Personal, created by Caterina Selva |
state_or_region | South Australia |
sub_species | NA |
taxon_id | 64495.0 |
taxonomic_group | Fungi |
temperature | NA |
ticket | BPAOPS-1762 |
tissue | Grain |
tissue_preservation | Nucleic acid in MQ water, stored at -20C |
tissue_preservation_temperature | -20.0 |
type_status | NA |
wild_captive | None, found growing on maize grains |
work_order | 21003.0 |