Serendipita, reference genome, ont-promethion, Mycelium
Dataset size is: 29.43 GiB
This dataset is currently under a short embargo period until July 11, 2026 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
-
FUN_BRF_PBE72074_metadata.xlsx Metadata Only XLSX
-
FUN_BRF_PBE72074_ONTPromethION_b... Metadata Only
-
FUN_BRF_PBE72074_ONTPromethION_r... Metadata Only HTML
-
467237_FUN_BRF_PBE72074_ONTProme... Metadata Only TAR
-
467237_FUN_BRF_PBE72074_ONTProme... Metadata Only TAR
-
FUN_BRF_PBE72074_ONTPromethION_s... Metadata Only
-
FUN_BRF_PBE72074_ONTPromethION_pod5.tar Metadata Only TAR
Optional
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:fungi-consortium-members |
| Access Control Date | 2026-07-11 |
| Access Control Mode | date |
| Sequence Data Type | ont-promethion |
| altitude | NA |
| analysis_software | MinKNOW 24.11.11 |
| ancillary_notes | 2046.0 |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/fungi_staging/ont-promethion/BPAOPS-1827/20250707_FUN_BRF_PBE72074/ |
| bioplatforms_dataset_id | 102.100.100/467825 |
| bioplatforms_library_id | 102.100.100/467237 |
| bioplatforms_project | Australian Functional Fungi Initiative |
| bioplatforms_sample_id | 102.100.100/465185 |
| ccg_jira_ticket | BPAOPS-1827 |
| cell_postion | 3C |
| class | Agaricomycetes |
| collection_date | 2017-10-17 |
| collection_method | Isolation of pelotons from plant material |
| collection_permit | SL100294 |
| collector | Fitria Oktalira |
| common_name | Serendipita |
| country | Australia |
| data_context | reference genome |
| data_type | ONT-promethion |
| date_of_transfer | 2025-07-11 |
| date_of_transfer_to_archive | 2025-07-16 |
| depth | NA |
| dna_treatment | Blue pippin 10 Kb size selection |
| env_broad_scale | Woodland biome |
| env_local_scale | NA |
| env_medium | NA |
| experimental_design | ONT long reads |
| facility_project_code | NA |
| facility_sample_id | 964-3 |
| family | Serendipitaceae |
| fast5_compression | pod5 bvz |
| flow_cell_id | PBE72074 |
| flowcell_id | PBE72074 |
| flowcell_type | FLO-PRO114M |
| folder_name | 20250707_FUN_BRF_PBE72074 |
| genus | Serendipita |
| habitat | NA |
| health_state | Healthy |
| host_common_name | Orchid |
| host_family | Orchidaceae |
| host_organ | Collar |
| host_scientific_name | Cyrtostylis reniformis |
| host_status | Wild |
| host_symptom | Asymptomatic |
| identified_by | Fitria Oktalira |
| indigenous_location | Ngunnawal and Ngambri |
| insert_size_range | 30 Kbp |
| isolate | CLM 2046 |
| library_construction_protocol | Native barcoded ligation libraries with NBD114 |
| library_id | 467237 |
| library_index_id | barcode13 |
| library_index_seq | AGAACGACTTCCATACTCGTGTGA |
| library_layout | NA |
| library_location | BRF labs |
| library_ng_ul | 39.6 |
| library_oligo_sequence | 5' - AAGGTTAA - barcode - CAGCACCT - 3' |
| library_prep_date | 2025-07-07 |
| library_prepared_by | Carolina Correa-Ospina |
| library_selection | random |
| library_source | genomic |
| library_strategy | WGS |
| library_type | ont-promethion |
| life_stage | mature plant |
| location_info_restricted | Yes |
| location_text | Black Mountain |
| material_conc_ng_ul | 30.4 |
| material_extracted_by | Eric Perreira |
| material_extraction_date | 2023-11-01 |
| material_extraction_type | DNA |
| metadata_revision_date | 2025-07-04 |
| metadata_revision_filename | FUN_MASTER_sample_metadata_FORDP_20250704_NOLATLON.xlsx |
| model_base_caller | Super-accurate basecalling v4.3.0, 400 bps |
| n_libraries_pooled | 5.0 |
| order | Sebacinales |
| phylum | Basidiomycota |
| project_lead | Celeste Linde |
| sample_collection_type | Mycelium |
| sample_custodian | Celeste Linde |
| sample_id | CLM 2046 |
| sample_id_description | Fungal sample |
| sample_quality | Good |
| sample_type | Fungus |
| scientific_name | Serendipita sp. |
| scientific_name_authorship | NA |
| scientific_name_note | Orchid Mycorrhizal Fungi |
| sequencing_facility | BRF |
| sequencing_kit_chemistry_version | SQK-NBD114.24 |
| sequencing_model | ONT PromethION |
| sequencing_platform | Oxford Nanopore |
| source_population | NA |
| species | OTU R |
| specimen_id | CLM 2046 |
| specimen_id_description | Australian National University |
| state_or_region | Australian Capitol Territory |
| sub_species | NA |
| taxon_id | NA |
| taxonomic_group | Fungi |
| temperature | NA |
| ticket | BPAOPS-1827 |
| tissue | Mycelium |
| tissue_preservation | Frozen |
| tissue_preservation_temperature | -80.0 |
| wild_captive | Wild |
| work_order | 21029.0 |