Grasslands Hi-C, Reference genomes, Sample ID 369564
Dataset size is: 0.00 Bit
This dataset is currently under a short embargo period until December 31, 2025 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
The embargo is for the following reason:
Extend embargo until Dec 31, 2025
Data and Resources
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:782:grassland-consortium-members |
| Access Control Reason | Extend embargo until Dec 31, 2025 |
| Access Control Date | 2025-12-31 |
| Access Control Mode | date |
| Sequence Data Type | illumina-hic |
| Related Data | Hi-C |
| analysis_software | Bcl2Fastq |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/grasslands/genomics-hi-c/BPAOPS-1514/20231109_AG_BRF_HMMYTDRX3/ |
| bioplatforms_project | Australian Grasslands Initiative (AG) |
| ccg_jira_ticket | BPAOPS-1514 |
| collected_by | Rachael Gallagher |
| collection_date | 2021-06-16 |
| common_name | Kangaroo grass |
| country | Australia |
| data_context | Reference genome |
| data_type | Main dataset |
| dataset_id | 373565 |
| date_of_transfer | 2023-11-10 |
| date_of_transfer_to_archive | 2023-11-14 |
| decimal_latitude_public | -33.39 |
| decimal_longitude_public | 151.33 |
| description | Hi-C |
| dna_treatment | FA crosllinking restriction enzymes and sonication |
| download | https://data.bioplatforms.com/dataset?ext_search_by=&q=ticket%3ABPAOPS-1514 |
| experimental_design | Arima HiC 2.0 single index |
| facility | BRF |
| facility_sample_id | 369564_LibID371565_AG_BRF_HMMYTDRX3_TCAGCATC |
| family | Poaceae |
| fast5_compression | .gz |
| flowcell_id | HMMYTDRX3 |
| flowcell_type | NovaSeq 6000 SP |
| folder_name | 20231109_AG_BRF_HMMYTDRX3 |
| growth_facility | Macquarie University Plant Growth facility |
| id_vetting_by | Karen |
| initiative_prefix | Grasslands |
| insert_size_range | ~1000bp |
| latitude | -33.39 |
| library_comments | Concentration and size was assesd by TapeStation and Qubit |
| library_construction_protocol | Arima HiC 2.0 |
| library_id | 371565 |
| library_index_id | Index_5 |
| library_index_seq | TCAGCATC |
| library_layout | paired-end |
| library_location | Freezer at BRF |
| library_ng_ul | 1.6 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCAGCATC (AT)CTCGTATGCCGTCTTCTGCTTG |
| library_pcr_cycles | 6 |
| library_pcr_reps | 1 |
| library_prep_date | 2023-11-02 |
| library_prepared_by | Max Nekrasov |
| library_selection | Restriction Digest |
| library_source | GENOMIC |
| library_strategy | Hi-C |
| library_type | Illumina-HiC |
| location_id | Narara |
| longitude | 151.33 |
| metadata_revision_date | 2024-01-03 |
| metadata_revision_filename | Australian_grasslands_metadata_combined_2023-10-05_forQCIF_2.xlsx |
| n_libraries_pooled | 1 |
| plant_developmental_stage | Floret emergence |
| plant_growth_medium | Standard MQ loam |
| ploidy | 2n |
| project_aim | Reference genomes |
| sample_id | 102.100.100/369564 |
| sample_replicate | NA |
| sample_submitter_name | Ashley Jones |
| scientific_name | Themeda triandra |
| scientific_name_authorship | Forssk |
| sequencing_facility | BRF |
| sequencing_kit_chemistry_version | NovaSeq v1.5 |
| sequencing_model | Illumina NovaSeq 6000 |
| sequencing_platform | Illumina |
| state_or_territory | NSW |
| taxon_id | 106636 |
| team_lead_email | brian.atwell@mq.edu.au |
| team_lead_name | Brian Atwell |
| ticket | BPAOPS-1514 |
| work_order | WO16004 |