Spidery wattle/Balcanoona wattle, Population genetics, Illumina FASTQ, Leaf
Dataset size is: 0.00 Bit
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members |
| Access Control Date | 2023-05-25 |
| Access Control Mode | date |
| Sequence Data Type | illumina-ddrad |
| access_rights | location information |
| associated_media | photo |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/ddrad/BPAOPS-1265/AGRF_TSI_H7KHDRX2_358765/ |
| bpa_dataset_id | 102.100.100/358765 |
| class | Magnoliopsida |
| collection_date | 2021-10-10 |
| collection_method | Removal of leaves from living plant, and storing on silica gel. Refer to methods in https://doi.org/10.3390/d12080346 |
| collector | Colette Blyth, Shannon Evendon, University of Adelaide |
| common_name | Spidery wattle/Balcanoona wattle |
| country | Australia |
| data_context | Population genetics |
| data_custodian | Colette Blyth |
| data_type | Illumina FASTQ |
| dataset_id | 102.100.100/358765 |
| date_of_transfer | 2022-05-25 |
| date_of_transfer_to_archive | 2022-05-26 |
| description | ddRAD (dataset ID 358765) |
| experimental_design | PstI and MseI |
| facility_project_code | QAGRF22019383 |
| family | Leguminosae |
| flowcell_id | H7KHFDRX2 |
| flowcell_type | S1 300 |
| folder_name | AGRF_TSI_H7KHDRX2_358765 |
| genotypic_sex | not determined |
| genus | Acacia |
| habitat | Arid, mounatinous |
| health_state | healthy |
| insert_size_range | 280-342 |
| institution_name | University of Adelaide |
| library_construction_protocol | ddRAD (based on Peterson et al 2012) |
| library_index_id_dual | PP7i4 |
| library_index_seq_dual | TGACCA |
| library_location | AGRF Melbourne |
| library_ng_ul | 2.21 |
| library_oligo_sequence_dual | CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCAGACGTGTG*C |
| library_pcr_cycles | 11.0 |
| library_pcr_reps | 7.0 |
| library_prep_date | 2022-04-12 |
| library_prepared_by | Simon Farrelly |
| library_selection | Reduced Representation |
| library_source | Genomic |
| library_strategy | RAD-Seq |
| library_type | ddRAD |
| lifestage | seedling |
| location_text | Arkaroola sanctuary. ~2km south of Arkaroola village |
| metadata_revision_date | 2024-08-28 |
| metadata_revision_filename | 20240829_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx |
| n_libraries_pooled | 1.0 |
| order | Fabales |
| phenotypic_sex | not determined |
| phylum | Spermatophyta |
| sample_custodian | Coletter Blyth, University of Adelaide |
| sample_quality | Good |
| sample_type | Leaf tissue |
| scientific_name | Acacia araneosa |
| scientific_name_authorship | D.J.E. Whibley 1976 |
| sequencing_facility | AGRF Melbourne |
| sequencing_model | Illumina NovaSeq 6000 |
| sequencing_platform | ILLUMINA |
| species | araneosa |
| specimen_id | AA_S_CAM_09 |
| specimen_id_description | University of adelaide - Advanced DNA, Identification and Forensic Facility internal identifier |
| state_or_region | South Australia |
| taxon_id | 1174718.0 |
| taxonomic_group | Plant |
| ticket | BPAOPS-1265 |
| tissue_collection_type | University |
| tissue_number | AA_S_CAM_09_leaf |
| tissue_preservation | Silica gel |
| tissue_preservation_temperature | Room temperature |
| tissue_type | Leaf |
| work_order | 14022 |