Swan galaxias, Population Genetics, Illumina ddRAD-seq, Fin
Dataset size is: 0.00 Bit
This dataset is currently under a short embargo period until August 1, 2025 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
This dataset has no data
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Geospatial Coverage |
Dataset extentMap tiles & Data by OpenStreetMap, under CC BY SA.
|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members |
| Access Control Date | 2025-08-01 |
| Access Control Mode | date |
| Sequence Data Type | illumina-ddrad |
| access_rights | No restrictions |
| ala_specimen_url | NA |
| ancillary_notes | NA |
| associated_media | NA |
| barcode_id | NA |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/ddrad/BPAOPS-1631/20240729_TSI_AGRF_22MN5JLT3/ |
| bioplatforms_project | Threatened Species Initiative |
| bpa_dataset_id | 102.100.100/358844 |
| certainty | not determined |
| class | Actinopterygii |
| collection_date | 2024-01-16 |
| collection_method | Electrofishing |
| collector | Rob Freeman, Bruce Deagle |
| common_name | Swan galaxias |
| country | Australia |
| data_context | Population Genetics |
| data_custodian | Charlotte Jensen |
| data_type | Illumina ddRAD-seq |
| dataset_id | 102.100.100/358844 |
| date_of_transfer | 2024-08-01 |
| date_of_transfer_to_archive | 2024-08-02 |
| death_date | 2024-01-16 |
| decimal_latitude_public | 41.74 |
| decimal_longitude_public | 148.08 |
| description | Galaxias ddRAD |
| experimental_design | PstI/MseI |
| family | Galaxiidae |
| flowcell_id | 22MN5JLT3 |
| flowcell_type | 10B |
| folder_name | 20240729_TSI_AGRF_22MN5JLT3 |
| genotypic_sex | not determined |
| genus | Galaxias |
| habitat | River |
| health_state | unknown |
| insert_size_range | 280-342bp |
| institution_name | CSIRO |
| latitude | 41.74 |
| library_construction_protocol | ddRAD (based on Peterson et al 2012) |
| library_layout | paired end |
| library_location | AGRF_Perth |
| library_oligo_sequence | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC*G |
| library_pcr_cycles | 11.0 |
| library_pcr_reps | 7.0 |
| library_prep_date | 2024-07-12 |
| library_prepared_by | Daniel Brescianini |
| library_selection | Restriction Digest |
| library_source | GENOMIC |
| library_strategy | RAD-Seq |
| library_type | Illumina-ddRAD |
| lifestage | unknown |
| location_text | St. Pauls River (above Meadstone Falls) |
| longitude | 148.08 |
| material_conc_ng_ul | unknown |
| material_extracted_by | Charlotte Jense |
| material_extraction_method | Dneasy Blood & Tissue kit |
| material_extraction_type | DNA |
| metadata_revision_date | 2024-08-28 |
| metadata_revision_filename | 20240829_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx |
| method_of_determination | not determined |
| n_libraries_pooled | 2.0 |
| order | Galaxiiformes |
| phenotypic_sex | not determined |
| phylum | Chordata |
| prior_genetics | NA |
| sample_custodian | Bruce Deagle |
| sample_type | Tissue sample, whole organism |
| scientific_name | Galaxias fontanus |
| scientific_name_authorship | Fulton, 1978 |
| sequencing_facility | AGRF_Melbourne |
| sequencing_model | NovaSeq X Plus |
| sequencing_platform | ILLUMINA |
| source_population | St. Pauls river |
| species | fontanus |
| specimen_id | GF4_2024 |
| specimen_id_description | Created by researcher as followes: the 2 letters correspond with the species name Galaxias brevipinnis and the number is unique for each sample |
| state_or_region | Tasmania |
| taxon_id | 66448.0 |
| taxonomic_group | Fish |
| ticket | BPAOPS-1631 |
| tissue_collection | CSIRO National Fish Collection |
| tissue_number | GF4_2024 |
| tissue_preservation | Ethanol, +4C |
| tissue_preservation_temperature | 4.0 |
| tissue_type | Fin |
| type_status | unknown |
| wild_captive | wild |
| work_order | 14056 |