green and golden bell frog, Reference genome (HiC), Illumina-HiC, muscle structure
Dataset size is: 0.00 Bit
Data and Resources
This dataset has no data
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members |
| Access Control Date | 2023-07-13 |
| Access Control Mode | date |
| Sequence Data Type | illumina-hic |
| access_rights | no restrictions |
| analysis_software | Bcl2Fastq |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/genomics-hi-c/BPAOPS-1309/20220711_TSI_BRF_HG5YLDMXY/ |
| ccg_jira_ticket | BPAOPS-1309 |
| certainty | certain |
| class | Amphibia |
| collection_method | Frog was removed from outdoor enclosure by hand |
| collector | Anthony Waddle, University of Melbourne/Macquarie University |
| collector_sample_id | MaleTub17 |
| common_name | green and golden bell frog |
| country | Australia |
| data_context | Reference genome (HiC) |
| data_custodian | Anthony Wardle |
| data_type | Illumina-HiC |
| dataset_id | 102.100.100/358779 |
| date_of_transfer | 2022-07-13 |
| date_of_transfer_to_archive | 2022-08-09 |
| description | Hi-C multiple species |
| dna_treatment | FA crosllinking restriction enzymes and sonication |
| download | researcher informed |
| experimental_design | Arima HiC 2.0 single index |
| facility_project_code | BRF |
| facility_sample_id | 408028_AusARG_BRF_XXXXX_GTCCGC |
| family | Pelodryadidae |
| file_type | FASTQ |
| flowcell_id | HG5YLDMXY |
| flowcell_type | Novaseq S2 |
| folder_name | 20220711_TSI_BRF_HG5YLDMXY |
| genus | Litoria |
| habitat | Waste emplacement dam |
| insert_size_range | 150bp PE |
| institution_name | Macquarie University |
| library_comments | Concentration and size was assesd by Bioanalyzer and Qubit |
| library_construction_protocol | Arima HiC 2.0 |
| library_id | 408028 |
| library_index_id | Index_18 |
| library_index_seq | GTCCGC |
| library_layout | paired end |
| library_location | Freezer at BRF |
| library_ng_ul | 1.6 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGC(AT)CTCGTATGCCGTCTTCTGCTTG |
| library_pcr_cycles | 6 |
| library_pcr_reps | 1 |
| library_prep_date | 2022-06-30 |
| library_prepared_by | Max Nekrasov |
| library_selection | Restriction Digest |
| library_source | GENOMIC |
| library_strategy | Hi-C |
| library_type | Illumina-HiC |
| lifestage | adult organism |
| location_text | Kooragang Island |
| material_extracted_by | Anthony Waddle |
| material_extraction_type | DNA |
| metadata_revision_date | 2023-11-30 |
| metadata_revision_filename | 20231130_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx |
| method_of_determination | conspicuous sexual characteristics such as nuptual pads and coloured throat patch. |
| n_libraries_pooled | 6 |
| order | Anura |
| phenotypic_sex | male |
| phylum | Chordata |
| sample_custodian | Anthony Waddle, Rick Shine, Simon Clulow |
| sample_id | 102.100.100/405646 |
| sample_quality | Flash Frozen |
| sample_type | tissue sample |
| scientific_name | Litoria aurea |
| scientific_name_authorship | Lesson, 1829 |
| scientific_name_note | sometimes called Ranoidea aurea |
| sequencing_facility | BRF |
| sequencing_kit_chemistry_version | NovaSeq v1.5 |
| sequencing_model | Illumina NovaSeq 6000 |
| sequencing_platform | ILLUMINA |
| source_population | Kooragang Island |
| species | aurea |
| specimen_id | 356208.0 |
| specimen_id_description | Specimen is a male Litoria aurea from Macquarie University Fauna Park Colony taken from tub 17 in July 2021 |
| state_or_region | New South Wales |
| subspecies | n/a |
| taxon_id | 312085.0 |
| taxonomic_group | Amphibian |
| ticket | BPAOPS-1309 |
| tissue_collection | MQ-MLA017 |
| tissue_collection_type | university |
| tissue_number | MQ-MLA017Muscle |
| tissue_preservation | -80C |
| tissue_preservation_temperature | -80C |
| tissue_type | muscle structure |
| wild_captive | captive |
| work_order | 13045 |