Orange-bellied parrot, Reference genome (HiC), Illumina-HiC, Heart
Dataset size is: 0.00 Bit
Data and Resources
This dataset has no data
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members |
| Access Control Date | 2023-07-13 |
| Access Control Mode | date |
| Sequence Data Type | illumina-hic |
| access_rights | Open Access |
| ala_specimen_url | https://bie.ala.org.au/species/urn:lsid:biodiversity.org.au:afd.taxon:bb3b5394-ebf7-41cc-8cd7-9f9bd28fa8e7 |
| analysis_software | Bcl2Fastq |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/genomics-hi-c/BPAOPS-1309/20220711_TSI_BRF_HG5YLDMXY/ |
| birth_date | 2014-12-27 |
| ccg_jira_ticket | BPAOPS-1309 |
| certainty | Certain |
| class | Aves |
| collection_date | 2020-02-08 |
| collection_method | Medical euthanasia |
| collector | Carolyn Hogg |
| collector_sample_id | 1.0 |
| common_name | Orange-bellied parrot |
| country | Australia |
| data_context | Reference genome (HiC) |
| data_custodian | Carolyn Hogg |
| data_type | Illumina-HiC |
| dataset_id | 102.100.100/358783 |
| date_of_transfer | 2022-07-13 |
| date_of_transfer_to_archive | 2022-08-09 |
| death_date | 2020-08-20 |
| decimal_latitude_public | -35.34 |
| decimal_longitude_public | 149.25 |
| description | Hi-C multiple species |
| dna_treatment | FA crosllinking restriction enzymes and sonication |
| download | researcher informed |
| experimental_design | Arima HiC 2.0 single index |
| facility_project_code | BRF |
| facility_sample_id | 408041_AusARG_BRF_XXXXX_CTTGTA |
| family | Psittacidae |
| file_type | FASTQ |
| flowcell_id | HG5YLDMXY |
| flowcell_type | Novaseq S2 |
| folder_name | 20220711_TSI_BRF_HG5YLDMXY |
| genus | Neophema |
| habitat | Coastal |
| health_state | Poor |
| insert_size_range | 150bp PE |
| institution_name | University of Sydney |
| latitude | -35.34 |
| library_comments | Concentration and size was assesd by Bioanalyzer and Qubit |
| library_construction_protocol | Arima HiC 2.0 |
| library_id | 408041 |
| library_index_id | Index_12 |
| library_index_seq | CTTGTA |
| library_layout | paired end |
| library_location | Freezer at BRF |
| library_ng_ul | 1.6 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTA(AT)CTCGTATGCCGTCTTCTGCTTG |
| library_pcr_cycles | 6 |
| library_pcr_reps | 1 |
| library_prep_date | 2022-06-30 |
| library_prepared_by | Max Nekrasov |
| library_selection | Restriction Digest |
| library_source | GENOMIC |
| library_strategy | Hi-C |
| library_type | Illumina-HiC |
| lifestage | adult |
| location_text | Priam Psitticulture Centre; 2 Australis Place, Queanbeyan, NSW 2621 |
| longitude | 149.25 |
| metadata_revision_date | 2023-11-30 |
| metadata_revision_filename | 20231130_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx |
| method_of_determination | Dissection |
| n_libraries_pooled | 6 |
| order | Psittaciformes |
| phenotypic_sex | male |
| phylum | Chordata |
| prior_genetics | DArTseq |
| sample_custodian | Carolyn Hogg |
| sample_id | 102.100.100/405730 |
| sample_quality | Good |
| sample_type | Organ |
| scientific_name | Neophema chrysogaster |
| sequencing_facility | BRF |
| sequencing_kit_chemistry_version | NovaSeq v1.5 |
| sequencing_model | Illumina NovaSeq 6000 |
| sequencing_platform | ILLUMINA |
| source_population | Captive metapopulation |
| species | chrysogaster |
| specimen_id | 2035.0 |
| specimen_id_description | Studbook number |
| state_or_region | New South Wales |
| taxon_id | 678581.0 |
| taxonomic_group | Bird |
| ticket | BPAOPS-1309 |
| tissue_collection | Euthanasia |
| tissue_collection_type | Insurance program |
| tissue_number | SBF_USYD_pooled_heart |
| tissue_preservation | Flash frozen |
| tissue_preservation_temperature | "-80C" |
| tissue_type | Heart |
| wild_captive | captive |
| work_order | 13045 |