Reference Genome, Illumina-HiC
Dataset size is: 38.36 GiB
This dataset is currently under a short embargo period until February 10, 2026 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members |
| Access Control Date | 2026-02-10 |
| Access Control Mode | date |
| Sequence Data Type | illumina-hic |
| analysis_software | DRAGEN BCLconvert |
| analysis_software_version | 4.1.23 |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/genomics-hi-c/BPAOPS-1746/ |
| bioplatforms_project | Threatened Species Initiative |
| ccg_jira_ticket | BPAOPS-1746 |
| data_context | Reference Genome |
| data_custodian | Carolyn Hogg |
| data_type | Illumina-HiC |
| dataset_id | 102.100.100/419498 |
| date_of_transfer | 2025-02-10 |
| date_of_transfer_to_archive | 2025-02-11 |
| dna_treatment | FA crosslinking |
| facility_project_code | NA |
| facility_sample_id | 417575_TSI_BRF_22KYTHLT4_CCAAGGTT |
| flowcell_id | 22KYTHLT4 |
| flowcell_type | NovaSeq X 25B |
| folder_name | 20250210_TSI_BRF_419498_22KYTHLT4 |
| genus | Macroderma |
| insert_size_range | ~600bp |
| library_construction_protocol | HiC Arima 2.0 |
| library_id | 417575 |
| library_index_id | NEB_Set1_B11 |
| library_index_seq | CCAAGGTT |
| library_layout | Paired end |
| library_location | BRF Freezer |
| library_ng_ul | 1.3 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCAAGGTT(AT)CTCGTATGCCGTCTTCTGCTTG |
| library_pcr_cycles | 7 |
| library_pcr_reps | 1 |
| library_prepared_by | Max Nekrasov |
| library_selection | Restriction digest |
| library_source | GENOMIC |
| library_strategy | HiC |
| library_type | illumina-hic |
| n_libraries_pooled | 1 |
| sample_id | 102.100.100/415572 |
| sequencing_facility | BRF |
| sequencing_model | NovaSeq X |
| sequencing_platform | Illumina |
| species | gigas |
| specimen_id | MG_PC43 |
| ticket | BPAOPS-1746 |
| tissue_number | MG_PC43 |
| work_order | 14082 |